Incidental Mutation 'R0323:Dnajc13'
ID25663
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission 038533-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R0323 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104156892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2188 (S2188P)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788] [ENSMUST00000188885]
Predicted Effect probably damaging
Transcript: ENSMUST00000035170
AA Change: S2183P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: S2183P

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186788
AA Change: S2188P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: S2188P

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000188139
AA Change: S51P
Predicted Effect probably benign
Transcript: ENSMUST00000188885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190926
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 94.2%
  • 20x: 86.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,298,555 T816S possibly damaging Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
4931429P17Rik A C 13: 47,961,017 noncoding transcript Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Accsl T A 2: 93,861,080 Q351L probably benign Het
Acot6 A C 12: 84,109,179 E300D probably benign Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Agps T A 2: 75,894,161 Y506* probably null Het
Appl1 A T 14: 26,942,738 V446D possibly damaging Het
Arcn1 A T 9: 44,759,059 I90N probably damaging Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Barx1 A G 13: 48,665,954 T243A probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Cacul1 A G 19: 60,543,060 I257T probably benign Het
Chml A T 1: 175,687,084 F424I probably benign Het
Clcn1 A T 6: 42,310,140 E710D probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dirc2 ACC AC 16: 35,719,360 probably null Het
Dyrk1b C A 7: 28,185,356 Q399K probably benign Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgr1 T C 3: 96,285,829 E284G possibly damaging Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Fsip2 T C 2: 82,985,896 I3991T probably benign Het
Galnt15 A T 14: 32,048,085 H249L probably damaging Het
Gm10803 T A 2: 93,564,070 Y62* probably null Het
Gm20730 G A 6: 43,081,515 probably null Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gmpr2 A G 14: 55,672,746 D11G probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hyal4 A T 6: 24,756,194 N137I probably benign Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Ldb3 G A 14: 34,544,045 T531I probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Loxhd1 A G 18: 77,369,137 I499V probably benign Het
Lrp2 T C 2: 69,469,639 Y3023C probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Lrriq1 A T 10: 103,221,289 C217S possibly damaging Het
Mmrn2 A T 14: 34,398,034 Q287L probably damaging Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Nrxn1 A C 17: 90,700,742 probably null Het
Olfr1130 G A 2: 87,607,497 M36I probably benign Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr430 A G 1: 174,069,327 T10A probably benign Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde11a C T 2: 76,046,774 probably null Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Polrmt T C 10: 79,741,998 T287A probably benign Het
Ppfia2 A G 10: 106,896,420 I943V possibly damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Scn9a T C 2: 66,568,131 E45G probably damaging Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Shc1 T C 3: 89,423,713 L106P probably damaging Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slc28a3 C A 13: 58,564,052 G487* probably null Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Spta1 A G 1: 174,218,451 T1594A probably damaging Het
Srarp G A 4: 141,433,379 Q48* probably null Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Trpc6 A T 9: 8,610,275 H248L probably damaging Het
Trpc6 A G 9: 8,643,536 K441E probably damaging Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Vmn1r63 A G 7: 5,803,336 V99A probably benign Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfhx2 C A 14: 55,065,979 S1516I possibly damaging Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGCAGTCTTATTCGTACCAGC -3'
(R):5'- GACTCAGTGTGTGATGGACACCAG -3'

Sequencing Primer
(F):5'- GCACATCTAACCGATGGTTTCTAAC -3'
(R):5'- ACACCAGGTCCTGGCTC -3'
Posted On2013-04-16