Incidental Mutation 'R0323:Appl1'
ID25672
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission 038533-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0323 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26942738 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 446 (V446D)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036570
AA Change: V446D

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: V446D

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 94.2%
  • 20x: 86.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,298,555 T816S possibly damaging Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
4931429P17Rik A C 13: 47,961,017 noncoding transcript Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Accsl T A 2: 93,861,080 Q351L probably benign Het
Acot6 A C 12: 84,109,179 E300D probably benign Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Agps T A 2: 75,894,161 Y506* probably null Het
Arcn1 A T 9: 44,759,059 I90N probably damaging Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Barx1 A G 13: 48,665,954 T243A probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Cacul1 A G 19: 60,543,060 I257T probably benign Het
Chml A T 1: 175,687,084 F424I probably benign Het
Clcn1 A T 6: 42,310,140 E710D probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dirc2 ACC AC 16: 35,719,360 probably null Het
Dnajc13 A G 9: 104,156,892 S2188P probably damaging Het
Dyrk1b C A 7: 28,185,356 Q399K probably benign Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgr1 T C 3: 96,285,829 E284G possibly damaging Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Fsip2 T C 2: 82,985,896 I3991T probably benign Het
Galnt15 A T 14: 32,048,085 H249L probably damaging Het
Gm10803 T A 2: 93,564,070 Y62* probably null Het
Gm20730 G A 6: 43,081,515 probably null Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gmpr2 A G 14: 55,672,746 D11G probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hyal4 A T 6: 24,756,194 N137I probably benign Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Ldb3 G A 14: 34,544,045 T531I probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Loxhd1 A G 18: 77,369,137 I499V probably benign Het
Lrp2 T C 2: 69,469,639 Y3023C probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Lrriq1 A T 10: 103,221,289 C217S possibly damaging Het
Mmrn2 A T 14: 34,398,034 Q287L probably damaging Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Nrxn1 A C 17: 90,700,742 probably null Het
Olfr1130 G A 2: 87,607,497 M36I probably benign Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr430 A G 1: 174,069,327 T10A probably benign Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde11a C T 2: 76,046,774 probably null Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Polrmt T C 10: 79,741,998 T287A probably benign Het
Ppfia2 A G 10: 106,896,420 I943V possibly damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Scn9a T C 2: 66,568,131 E45G probably damaging Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Shc1 T C 3: 89,423,713 L106P probably damaging Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slc28a3 C A 13: 58,564,052 G487* probably null Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Spta1 A G 1: 174,218,451 T1594A probably damaging Het
Srarp G A 4: 141,433,379 Q48* probably null Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Trpc6 A T 9: 8,610,275 H248L probably damaging Het
Trpc6 A G 9: 8,643,536 K441E probably damaging Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Vmn1r63 A G 7: 5,803,336 V99A probably benign Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfhx2 C A 14: 55,065,979 S1516I possibly damaging Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAACTGAAGGGCAAATACCTAAGAA -3'
(R):5'- TGTAGTCTGCTAAGCATTGAGCTTTTGA -3'

Sequencing Primer
(F):5'- CAGAAAAACCTGTATGTTTCTACCC -3'
(R):5'- TGAAAGAAAAAACTAAATTCAGTGCC -3'
Posted On2013-04-16