Incidental Mutation 'R0325:Unc80'
ID 25681
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C030018G13Rik, C230061B10Rik
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock # R0325 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66468367-66699148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 66510881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 766 (G766V)
Ref Sequence ENSEMBL: ENSMUSP00000148517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061620
AA Change: G766V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: G766V

Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212557
AA Change: G766V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 splice site probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 splice site probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
R7855:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66510707 missense probably benign 0.00
R8024:Unc80 UTSW 1 66606644 missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66483304 missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66648913 missense probably benign 0.00
R8135:Unc80 UTSW 1 66509287 missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66651533 missense probably benign 0.33
R8239:Unc80 UTSW 1 66654019 missense probably benign
R8249:Unc80 UTSW 1 66619491 missense probably benign 0.01
R8275:Unc80 UTSW 1 66640614 nonsense probably null
R8288:Unc80 UTSW 1 66473350 missense probably benign 0.07
R8341:Unc80 UTSW 1 66649033 missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66638028 nonsense probably null
R8456:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66473264 missense probably damaging 1.00
R8483:Unc80 UTSW 1 66693710 missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66612268 missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66638032 missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66608490 missense probably benign 0.01
R8755:Unc80 UTSW 1 66612131 missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66646395 missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66590229 missense probably benign 0.05
R8877:Unc80 UTSW 1 66527985 missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66473309 missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66472010 missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66606657 critical splice donor site probably null
R9095:Unc80 UTSW 1 66506753 missense probably damaging 1.00
R9125:Unc80 UTSW 1 66679581 missense probably benign 0.18
R9130:Unc80 UTSW 1 66638085 missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66549841 missense probably null 0.95
R9220:Unc80 UTSW 1 66507375 missense probably damaging 1.00
R9262:Unc80 UTSW 1 66555252 intron probably benign
R9334:Unc80 UTSW 1 66649760 missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66590301 missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66549938 critical splice donor site probably null
R9415:Unc80 UTSW 1 66510905 missense
R9427:Unc80 UTSW 1 66554999 missense probably damaging 1.00
R9436:Unc80 UTSW 1 66693805 critical splice donor site probably null
R9454:Unc80 UTSW 1 66695590 missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66638062 missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66570004 critical splice donor site probably null
R9552:Unc80 UTSW 1 66678123 missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66612128 missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66644326 missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66505020 missense probably damaging 0.99
R9789:Unc80 UTSW 1 66612212 missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66694409 missense probably benign
Z1177:Unc80 UTSW 1 66646398 missense possibly damaging 0.72
Z1177:Unc80 UTSW 1 66695339 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcacacacacacacacacac -3'
Posted On 2013-04-16