Incidental Mutation 'R2938:Tcf7'
ID256987
Institutional Source Beutler Lab
Gene Symbol Tcf7
Ensembl Gene ENSMUSG00000000782
Gene Nametranscription factor 7, T cell specific
SynonymsTcf1, T-cell factor 1, T cell factor-1, TCF-1
MMRRC Submission 040515-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R2938 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location52252371-52283014 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 52282783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086844] [ENSMUST00000109071]
Predicted Effect probably benign
Transcript: ENSMUST00000086844
SMART Domains Protein: ENSMUSP00000084055
Gene: ENSMUSG00000000782

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 100 2.2e-23 PFAM
low complexity region 119 130 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
HMG 187 257 2.86e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109071
SMART Domains Protein: ENSMUSP00000104699
Gene: ENSMUSG00000000782

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 100 5.3e-23 PFAM
low complexity region 119 130 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
HMG 187 257 2.86e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150973
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a transcription factor which is a member of the T-cell specific transcription factor family. The encoded protein is distinct from the hepatic transcription factor, transcription factor 1, which is also referred to by the symbol Tcf1. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice have defects in T cell development leading to decreased numbers of T cells in the periphery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,894,733 I1775K probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Astn2 A T 4: 65,992,313 H427Q possibly damaging Het
Bace2 T C 16: 97,412,188 probably null Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc73 T A 2: 104,975,635 L296* probably null Het
Cd40 G C 2: 165,069,702 V191L probably benign Het
Cdc6 A G 11: 98,910,760 I217V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Cstl1 T A 2: 148,751,057 I44N possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fkbp15 T A 4: 62,304,663 T1000S probably benign Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Gpr83 A G 9: 14,864,871 T163A probably benign Het
Hmgcr G A 13: 96,663,068 L173F probably damaging Het
Htr2b T A 1: 86,102,455 I173F possibly damaging Het
Ifna11 T C 4: 88,820,293 L112P probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Macf1 T C 4: 123,432,902 N2815S probably damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Man2b2 A G 5: 36,820,986 I318T probably benign Het
Mib1 T A 18: 10,752,033 probably benign Het
Myo10 T A 15: 25,795,717 S1315T probably damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr1032 T C 2: 86,008,013 M79T probably damaging Het
Olfr792 T A 10: 129,540,615 F26Y probably damaging Het
Olfr984 A T 9: 40,100,743 I249K probably benign Het
Opcml A G 9: 27,791,386 M1V probably null Het
Parm1 T C 5: 91,594,469 I232T possibly damaging Het
Pdss1 T A 2: 22,906,787 probably null Het
Pfkfb2 G A 1: 130,705,410 T202I possibly damaging Het
Postn T A 3: 54,370,310 F242Y probably damaging Het
Prss12 A G 3: 123,486,976 T437A probably benign Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Saraf A G 8: 34,168,581 N346D probably benign Het
Sec31b T C 19: 44,536,179 D93G probably damaging Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Sh3rf2 A G 18: 42,149,724 D449G probably benign Het
Slc9a3 T C 13: 74,121,669 I52T possibly damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Utp4 A G 8: 106,922,929 D670G probably damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdsub1 T C 2: 59,873,286 T112A possibly damaging Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Zfp808 G A 13: 62,171,218 V67M probably benign Het
Other mutations in Tcf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Tcf7 APN 11 52256996 missense probably damaging 1.00
IGL02558:Tcf7 APN 11 52253970 splice site probably benign
R1854:Tcf7 UTSW 11 52257064 missense probably benign 0.00
R2937:Tcf7 UTSW 11 52282783 splice site probably null
R3911:Tcf7 UTSW 11 52282966 start gained probably benign
R4433:Tcf7 UTSW 11 52261615 missense probably benign
R5796:Tcf7 UTSW 11 52261527 missense probably benign 0.31
R6443:Tcf7 UTSW 11 52253938 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTATAAAGGTCAGGGCACC -3'
(R):5'- CACTGGTGAATGAGTCCGAAG -3'

Sequencing Primer
(F):5'- CGGAAGTGACTCCAGCTCAG -3'
(R):5'- CGTCCGAGTACATGGAGAAGCC -3'
Posted On2014-12-31