Incidental Mutation 'R1555:Sry'
ID257006
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Namesex determining region of Chr Y
SynonymsTdy, Tdf
MMRRC Submission 039594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R1555 (G1)
Quality Score29
Status Validated
ChromosomeY
Chromosomal Location2662471-2663658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 2662975 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 228 (Q228H)
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
Predicted Effect unknown
Transcript: ENSMUST00000091178
AA Change: Q228H
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036
AA Change: Q228H

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 96% (43/45)
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,974,901 probably null Het
Adamts1 T A 16: 85,797,888 T358S probably benign Het
Ate1 A T 7: 130,509,091 F169I probably benign Het
Cdkl4 T A 17: 80,543,614 probably benign Het
Clcnkb T C 4: 141,411,739 probably null Het
Col6a4 C T 9: 106,000,886 R1964Q possibly damaging Het
Dcakd C T 11: 103,000,213 V17I probably damaging Het
Dcdc5 T G 2: 106,384,135 noncoding transcript Het
Erc2 T A 14: 28,011,665 D557E probably damaging Het
Grid2 A T 6: 64,429,684 D676V possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Igkv10-96 C T 6: 68,632,381 probably benign Het
Mier3 T A 13: 111,708,359 N248K probably damaging Het
Myo5b A T 18: 74,569,782 I15F probably damaging Het
Neurl3 A G 1: 36,266,532 V198A probably benign Het
Notch2 C A 3: 98,131,340 N1266K possibly damaging Het
Nup107 A G 10: 117,751,490 probably benign Het
Olfr214 A T 6: 116,556,826 I134F probably damaging Het
Olfr675 T C 7: 105,024,522 I153V probably benign Het
Phf3 G T 1: 30,805,877 H1334N possibly damaging Het
Phyhd1 T A 2: 30,274,706 I100N probably damaging Het
Rad21l T A 2: 151,658,428 T224S probably benign Het
Rxra C T 2: 27,748,678 A231V probably benign Het
Sac3d1 T C 19: 6,118,405 D61G probably damaging Het
Sbf1 A G 15: 89,305,076 Y481H probably damaging Het
Spg11 T C 2: 122,097,377 E642G probably damaging Het
Spta1 A G 1: 174,178,749 Y159C probably damaging Het
Tedc1 G T 12: 113,156,497 probably benign Het
Tmem200a A T 10: 25,993,884 D162E probably damaging Het
Tmprss11e T A 5: 86,715,588 Q206L probably damaging Het
Tpra1 A G 6: 88,910,203 N175S probably damaging Het
Ttll10 T C 4: 156,035,139 E601G probably benign Het
Ttll6 G T 11: 96,145,582 D346Y probably damaging Het
U2surp A G 9: 95,466,577 V874A probably damaging Het
Vwa5b1 T C 4: 138,605,477 K258R probably benign Het
Xkr6 A G 14: 63,818,925 Y95C unknown Het
Zfp180 T C 7: 24,101,574 probably benign Het
Zfp90 A G 8: 106,424,095 T147A probably benign Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5266:Sry UTSW Y 2662975 missense unknown
R5305:Sry UTSW Y 2662982 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7632:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8028:Sry UTSW Y 2662638 small deletion probably benign
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8252:Sry UTSW Y 2663298 missense possibly damaging 0.91
R8390:Sry UTSW Y 2662638 small deletion probably benign
R9027:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCATGGAACTGATGCTGCTGCTG -3'
(R):5'- AGTAGAGCTGCACACCTGTACTCC -3'

Sequencing Primer
(F):5'- atggaactgctgctgctgtt -3'
(R):5'- ccataaccaccaccagcag -3'
Posted On2015-01-07