Incidental Mutation 'R1580:Gm7361'
ID257011
Institutional Source Beutler Lab
Gene Symbol Gm7361
Ensembl Gene ENSMUSG00000059645
Gene Namepredicted gene 7361
Synonyms
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1580 (G1)
Quality Score41
Status Validated
Chromosome5
Chromosomal Location26257691-26264308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26257770 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 3 (L3F)
Ref Sequence ENSEMBL: ENSMUSP00000073781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074148]
Predicted Effect probably damaging
Transcript: ENSMUST00000074148
AA Change: L3F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073781
Gene: ENSMUSG00000059645
AA Change: L3F

DomainStartEndE-ValueType
Pfam:Takusan 50 134 2.1e-26 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Gm7361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Gm7361 APN 5 26257855 missense probably benign
IGL02550:Gm7361 APN 5 26261122 missense possibly damaging 0.79
R0011:Gm7361 UTSW 5 26258878 splice site probably benign
R0959:Gm7361 UTSW 5 26262053 missense possibly damaging 0.86
R1246:Gm7361 UTSW 5 26261227 nonsense probably null
R1654:Gm7361 UTSW 5 26261099 missense probably damaging 0.99
R2065:Gm7361 UTSW 5 26262151 missense probably damaging 1.00
R4864:Gm7361 UTSW 5 26262010 critical splice acceptor site probably null
R5386:Gm7361 UTSW 5 26258905 missense probably benign
R6282:Gm7361 UTSW 5 26260413 missense probably benign 0.13
R6391:Gm7361 UTSW 5 26258962 missense probably benign 0.37
R6769:Gm7361 UTSW 5 26257769 nonsense probably null
R7205:Gm7361 UTSW 5 26261118 missense probably damaging 0.99
R7497:Gm7361 UTSW 5 26261190 missense probably benign
R7498:Gm7361 UTSW 5 26261190 missense probably benign
R7499:Gm7361 UTSW 5 26261190 missense probably benign
Z1177:Gm7361 UTSW 5 26261188 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTAGTCCATGACATCAGCAGTCCC -3'
(R):5'- GCATTGCTTAGACCCACTGTCACTC -3'

Sequencing Primer
(F):5'- GACATCAGCAGTCCCTTCCTG -3'
(R):5'- GTTCCACATTACTGGAAAGGC -3'
Posted On2015-01-08