Mutagenetix > Incidental Mutation

Incidental Mutation 'R1780:Mroh2a'

257013

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

Heatr7b1, ENSMUSG00000044873, OTTMUSG00000020804

MMRRC Submission

039811-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R1780 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88226986-88262289 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 88230680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 150 (R150*)

Ref Sequence

ENSEMBL: ENSMUSP00000108755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

AlphaFold

D3Z750

Predicted Effect

probably null
Transcript: ENSMUST00000061013
AA Change: R150*

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: R150*

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113130
AA Change: R150*

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: R150*

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148474

Meta Mutation Damage Score

0.9666

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Trio	A	G	15: 27,744,038	C2603R	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88230746	missense	probably damaging	0.99
IGL00990:Mroh2a	APN	1	88244970	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88234120	missense	possibly damaging	0.76
IGL03097:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0068:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0139:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0374:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0583:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0613:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0657:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88228380	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0689:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0735:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0845:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88232257	frame shift	probably null
R0960:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1281:Mroh2a	UTSW	1	88256167	frame shift	probably null
R1414:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88241631	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88232353	splice site	probably benign
R1442:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1686:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1846:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88237491	nonsense	probably null
R2122:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2870:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2871:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3408:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3608:Mroh2a	UTSW	1	88244995	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3937:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88259589	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88251365	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88237944	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5031:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5062:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5301:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5615:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5825:Mroh2a	UTSW	1	88230680	nonsense	probably null
R5891:Mroh2a	UTSW	1	88241615	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88248655	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88230668	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6074:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6127:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6244:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6575:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6809:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88244083	splice site	probably null
R9414:Mroh2a	UTSW	1	88251374	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88242485	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88227091	start gained	probably benign
V8831:Mroh2a	UTSW	1	88256167	frame shift	probably null
X0027:Mroh2a	UTSW	1	88248613	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0028:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0033:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232292	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0039:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88255655	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0063:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCAAGCAGATGCGGGATATCACAG -3'
(R):5'- CAAGAGTTCCATATGCTTTTGCAGGTG -3'

Sequencing Primer
(F):5'- TAGTAGGCCCTGGATTCCAC -3'
(R):5'- TCTGAGTGGTAAGGACTAGGC -3'

Posted On

2015-01-08