Incidental Mutation 'R1686:Mroh2a'
ID257018
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R1686 (G1)
Quality Score23
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88234612 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
RF024:Mroh2a UTSW 1 88242485 missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACCCTGGCACTACGGAAATAAGC -3'
(R):5'- ACAAGATGGACTTGATCCAAGCCTG -3'

Sequencing Primer
(F):5'- CTGTCATTCCAGGTAGAAGGATCTC -3'
(R):5'- GGACTTGATCCAAGCCTGTATTTC -3'
Posted On2015-01-08