Incidental Mutation 'R2979:Smarcad1'
ID 257038
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene Name SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms D6Pas1, Etl1
Accession Numbers

Genbank: NM_007958; MGI: 95453
Essential gene? Possibly non essential (E-score: 0.419) question?
Stock # R2979 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 65042583-65116061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65075011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 376 (M376K)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]
AlphaFold Q04692
Predicted Effect probably benign
Transcript: ENSMUST00000031984
AA Change: M376K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: M376K

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204420
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm A G 5: 90,522,163 I48V probably benign Het
Arhgef1 A G 7: 24,907,751 E16G unknown Het
Cps1 T C 1: 67,204,704 probably null Het
Dnah9 T C 11: 66,117,588 K804E possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm18025 G T 12: 34,290,971 P41Q probably damaging Het
Kdm4c A T 4: 74,373,728 R861* probably null Het
Klhl2 C T 8: 64,823,078 V58I probably damaging Het
Msl1 G A 11: 98,800,224 G178E possibly damaging Het
Nacad T A 11: 6,601,424 Q589L probably benign Het
Pros1 A G 16: 62,913,866 D345G probably damaging Het
Sh3tc2 A G 18: 61,989,485 Y439C probably damaging Het
Srd5a1 T C 13: 69,600,299 Q127R probably damaging Het
Synm T G 7: 67,736,260 R551S probably damaging Het
Trmt1 A G 8: 84,696,882 Y301C probably damaging Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Txnl1 T C 18: 63,671,620 T268A probably benign Het
Zbbx C A 3: 75,078,486 E420* probably null Het
Zc3h7a A T 16: 11,158,973 V153E probably damaging Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65073239 missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65052806 unclassified probably benign
IGL03006:Smarcad1 APN 6 65083889 missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65074953 missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65092526 missense probably damaging 0.98
Trollip UTSW 6 65114336 missense probably damaging 1.00
wastrel UTSW 6 65052670 missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65084007 splice site probably benign
R0452:Smarcad1 UTSW 6 65074822 missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65108727 missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65096694 missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65052647 missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65067107 missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65056416 missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65073216 missense probably damaging 1.00
R3937:Smarcad1 UTSW 6 65114336 missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65056459 missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65067089 missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65052641 missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65075115 missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65075041 missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65098824 missense probably null 1.00
R4928:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65074762 missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65114329 missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65075138 missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65052670 missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65052732 missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65110376 missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65052711 missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65096049 missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65107830 missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65052782 missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65094319 missense probably benign
R8129:Smarcad1 UTSW 6 65067094 missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65083924 missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65052734 missense probably benign
R8795:Smarcad1 UTSW 6 65072049 missense probably benign 0.10
R9104:Smarcad1 UTSW 6 65098665 missense probably benign 0.06
R9133:Smarcad1 UTSW 6 65072051 missense probably damaging 0.99
R9400:Smarcad1 UTSW 6 65073230 missense probably damaging 0.97
R9401:Smarcad1 UTSW 6 65094337 missense probably benign 0.00
R9608:Smarcad1 UTSW 6 65114334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTGTGCTTCACAAAGTG -3'
(R):5'- TCCCTGGGCTGAAGACAATC -3'

Sequencing Primer
(F):5'- TTACAAATGGAAAAGAAGTTGCAAG -3'
(R):5'- GACAATCTGACTATAAACGGTACTG -3'
Posted On 2015-01-11