Mutagenetix > Incidental Mutation

Incidental Mutation 'R2979:Nacad'

257042

Institutional Source

Beutler Lab

Gene Symbol

Nacad

Ensembl Gene

ENSMUSG00000041073

Gene Name

NAC alpha domain containing

Synonyms

mKIAA0363

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6597823-6606053 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6601424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 589 (Q589L)

Ref Sequence

ENSEMBL: ENSMUSP00000049490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722]

AlphaFold

Q5SWP3

Predicted Effect

probably benign
Transcript: ENSMUST00000000388

SMART Domains

Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Blast:PTB	60	230	2e-35	BLAST
low complexity region	242	252	N/A	INTRINSIC
Pfam:CCM2_C	296	396	8.9e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000045713
AA Change: Q589L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: Q589L

Domain	Start	End	E-Value	Type
low complexity region	2	28	N/A	INTRINSIC
low complexity region	70	87	N/A	INTRINSIC
low complexity region	228	235	N/A	INTRINSIC
low complexity region	266	277	N/A	INTRINSIC
low complexity region	294	306	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
low complexity region	391	422	N/A	INTRINSIC
low complexity region	454	479	N/A	INTRINSIC
internal_repeat_1	537	689	6.19e-8	PROSPERO
low complexity region	692	713	N/A	INTRINSIC
internal_repeat_1	732	889	6.19e-8	PROSPERO
low complexity region	924	939	N/A	INTRINSIC
low complexity region	1159	1170	N/A	INTRINSIC
low complexity region	1308	1325	N/A	INTRINSIC
Pfam:NAC	1357	1413	2.9e-24	PFAM
low complexity region	1449	1466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109721

SMART Domains

Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

Domain	Start	End	E-Value	Type
Blast:PTB	2	166	2e-32	BLAST
low complexity region	178	188	N/A	INTRINSIC
low complexity region	230	244	N/A	INTRINSIC
PDB:4FQN\|D	245	324	5e-52	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000109722

SMART Domains

Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

Domain	Start	End	E-Value	Type
Blast:PTB	2	166	2e-32	BLAST
low complexity region	178	188	N/A	INTRINSIC
low complexity region	230	244	N/A	INTRINSIC
PDB:4FQN\|D	245	324	5e-52	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177050

Predicted Effect

probably benign
Transcript: ENSMUST00000177391

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afm	A	G	5: 90,522,163	I48V	probably benign	Het
Arhgef1	A	G	7: 24,907,751	E16G	unknown	Het
Cps1	T	C	1: 67,204,704		probably null	Het
Dnah9	T	C	11: 66,117,588	K804E	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Gm18025	G	T	12: 34,290,971	P41Q	probably damaging	Het
Kdm4c	A	T	4: 74,373,728	R861*	probably null	Het
Klhl2	C	T	8: 64,823,078	V58I	probably damaging	Het
Msl1	G	A	11: 98,800,224	G178E	possibly damaging	Het
Pros1	A	G	16: 62,913,866	D345G	probably damaging	Het
Sh3tc2	A	G	18: 61,989,485	Y439C	probably damaging	Het
Smarcad1	T	A	6: 65,075,011	M376K	probably benign	Het
Srd5a1	T	C	13: 69,600,299	Q127R	probably damaging	Het
Synm	T	G	7: 67,736,260	R551S	probably damaging	Het
Trmt1	A	G	8: 84,696,882	Y301C	probably damaging	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Txnl1	T	C	18: 63,671,620	T268A	probably benign	Het
Zbbx	C	A	3: 75,078,486	E420*	probably null	Het
Zc3h7a	A	T	16: 11,158,973	V153E	probably damaging	Het

Other mutations in Nacad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00597:Nacad	APN	11	6600921	missense	probably benign	0.24
IGL00903:Nacad	APN	11	6600632	missense	probably damaging	0.99
IGL01303:Nacad	APN	11	6598279	missense	possibly damaging	0.81
IGL01353:Nacad	APN	11	6600530	missense	possibly damaging	0.70
IGL01833:Nacad	APN	11	6605700	missense	unknown
IGL02267:Nacad	APN	11	6602649	missense	probably benign	0.14
IGL02531:Nacad	APN	11	6598580	missense	possibly damaging	0.90
IGL02994:Nacad	APN	11	6599528	missense	possibly damaging	0.83
IGL03121:Nacad	APN	11	6600933	missense	probably damaging	0.98
IGL03161:Nacad	APN	11	6600378	nonsense	probably null
Locusta	UTSW	11	6602387	missense	possibly damaging	0.88
migratoria	UTSW	11	6601196	missense	probably benign	0.30
FR4340:Nacad	UTSW	11	6599761	small insertion	probably benign
FR4342:Nacad	UTSW	11	6599762	small insertion	probably benign
FR4548:Nacad	UTSW	11	6599752	small insertion	probably benign
FR4548:Nacad	UTSW	11	6599760	small insertion	probably benign
FR4589:Nacad	UTSW	11	6599753	small insertion	probably benign
FR4976:Nacad	UTSW	11	6599749	small insertion	probably benign
FR4976:Nacad	UTSW	11	6599756	small insertion	probably benign
FR4976:Nacad	UTSW	11	6599763	small insertion	probably benign
PIT4402001:Nacad	UTSW	11	6598621	missense	probably benign	0.19
R0330:Nacad	UTSW	11	6600903	missense	probably benign
R0331:Nacad	UTSW	11	6599441	missense	possibly damaging	0.84
R0409:Nacad	UTSW	11	6599810	missense	probably benign	0.00
R0612:Nacad	UTSW	11	6601382	missense	possibly damaging	0.90
R0644:Nacad	UTSW	11	6599486	missense	possibly damaging	0.69
R0829:Nacad	UTSW	11	6601158	missense	probably benign	0.18
R1483:Nacad	UTSW	11	6602217	missense	probably damaging	0.99
R1583:Nacad	UTSW	11	6601185	missense	probably benign	0.08
R1905:Nacad	UTSW	11	6602540	missense	probably benign	0.15
R1907:Nacad	UTSW	11	6602540	missense	probably benign	0.15
R2361:Nacad	UTSW	11	6600821	missense	probably benign
R4192:Nacad	UTSW	11	6605534	missense	probably benign	0.44
R4381:Nacad	UTSW	11	6600204	missense	probably benign	0.18
R4539:Nacad	UTSW	11	6600677	missense	possibly damaging	0.94
R4751:Nacad	UTSW	11	6605726	missense	unknown
R4944:Nacad	UTSW	11	6598507	missense	possibly damaging	0.95
R4962:Nacad	UTSW	11	6599169	missense	probably damaging	1.00
R5102:Nacad	UTSW	11	6598528	missense	probably damaging	1.00
R5189:Nacad	UTSW	11	6601611	missense	probably damaging	0.98
R5296:Nacad	UTSW	11	6605745	missense	unknown
R5566:Nacad	UTSW	11	6602136	missense	probably damaging	1.00
R5634:Nacad	UTSW	11	6602387	missense	possibly damaging	0.88
R5725:Nacad	UTSW	11	6601643	missense	probably benign	0.15
R5748:Nacad	UTSW	11	6598370	nonsense	probably null
R5864:Nacad	UTSW	11	6600581	missense	probably benign
R5882:Nacad	UTSW	11	6598568	missense	possibly damaging	0.95
R6089:Nacad	UTSW	11	6601331	missense	probably benign	0.03
R6117:Nacad	UTSW	11	6599810	missense	probably benign	0.00
R6161:Nacad	UTSW	11	6600902	missense	probably benign
R6351:Nacad	UTSW	11	6599235	missense	probably damaging	1.00
R6351:Nacad	UTSW	11	6600165	nonsense	probably null
R6366:Nacad	UTSW	11	6601196	missense	probably benign	0.30
R6525:Nacad	UTSW	11	6602255	missense	probably damaging	1.00
R6811:Nacad	UTSW	11	6599400	missense	possibly damaging	0.66
R6931:Nacad	UTSW	11	6601877	missense	probably benign	0.14
R6966:Nacad	UTSW	11	6602634	missense	possibly damaging	0.93
R7228:Nacad	UTSW	11	6598412	missense	probably benign	0.19
R7248:Nacad	UTSW	11	6598589	nonsense	probably null
R7556:Nacad	UTSW	11	6601272	missense	possibly damaging	0.90
R7594:Nacad	UTSW	11	6602457	missense	probably damaging	0.99
R7813:Nacad	UTSW	11	6599071	missense	probably benign	0.38
R7841:Nacad	UTSW	11	6601031	missense	probably benign	0.00
R8243:Nacad	UTSW	11	6602643	missense	probably damaging	0.96
R8810:Nacad	UTSW	11	6602853	missense	probably benign	0.15
R9042:Nacad	UTSW	11	6598948	missense	possibly damaging	0.95
R9057:Nacad	UTSW	11	6600876	missense	possibly damaging	0.53
R9114:Nacad	UTSW	11	6602252	missense	probably damaging	1.00
R9328:Nacad	UTSW	11	6602417	missense	possibly damaging	0.84
R9394:Nacad	UTSW	11	6599390	missense	probably damaging	1.00
R9595:Nacad	UTSW	11	6601790	missense	probably damaging	0.99
R9755:Nacad	UTSW	11	6599374	critical splice donor site	probably null
R9760:Nacad	UTSW	11	6601662	missense	probably benign	0.02
T0975:Nacad	UTSW	11	6599750	small insertion	probably benign
T0975:Nacad	UTSW	11	6601622	missense	probably benign	0.03
T0975:Nacad	UTSW	11	6601632	missense	probably benign	0.17
X0011:Nacad	UTSW	11	6601074	missense	probably benign	0.00
Z1176:Nacad	UTSW	11	6602297	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGGTATTGTGACACCTCC -3'
(R):5'- AATAGCCAGGAATCAGTTGCAG -3'

Sequencing Primer
(F):5'- GGTATTGTGACACCTCCCTCAG -3'
(R):5'- CCAGGAATCAGTTGCAGAAATAGC -3'

Posted On

2015-01-11