Incidental Mutation 'R2979:Zc3h7a'
ID257048
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Namezinc finger CCCH type containing 7 A
SynonymsZc3h7, A430104C18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2979 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11136592-11176393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11158973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 153 (V153E)
Ref Sequence ENSEMBL: ENSMUSP00000120720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000125537] [ENSMUST00000128083] [ENSMUST00000130355] [ENSMUST00000138185] [ENSMUST00000140755] [ENSMUST00000142389]
Predicted Effect probably damaging
Transcript: ENSMUST00000037633
AA Change: V153E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965
AA Change: V153E

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125537
SMART Domains Protein: ENSMUSP00000122525
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:TPR 43 76 2e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000128083
AA Change: V153E

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965
AA Change: V153E

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000130355
AA Change: V153E

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120931
Gene: ENSMUSG00000037965
AA Change: V153E

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 4.4e-9 PFAM
Blast:TPR 124 156 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000138185
AA Change: V153E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965
AA Change: V153E

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000140755
AA Change: V153E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965
AA Change: V153E

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142389
SMART Domains Protein: ENSMUSP00000114432
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:TPR 43 76 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm A G 5: 90,522,163 I48V probably benign Het
Arhgef1 A G 7: 24,907,751 E16G unknown Het
Cps1 T C 1: 67,204,704 probably null Het
Dnah9 T C 11: 66,117,588 K804E possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm18025 G T 12: 34,290,971 P41Q probably damaging Het
Kdm4c A T 4: 74,373,728 R861* probably null Het
Klhl2 C T 8: 64,823,078 V58I probably damaging Het
Msl1 G A 11: 98,800,224 G178E possibly damaging Het
Nacad T A 11: 6,601,424 Q589L probably benign Het
Pros1 A G 16: 62,913,866 D345G probably damaging Het
Sh3tc2 A G 18: 61,989,485 Y439C probably damaging Het
Smarcad1 T A 6: 65,075,011 M376K probably benign Het
Srd5a1 T C 13: 69,600,299 Q127R probably damaging Het
Synm T G 7: 67,736,260 R551S probably damaging Het
Trmt1 A G 8: 84,696,882 Y301C probably damaging Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Txnl1 T C 18: 63,671,620 T268A probably benign Het
Zbbx C A 3: 75,078,486 E420* probably null Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 11137338 missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 11145242 missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 11153182 missense probably benign 0.28
IGL01285:Zc3h7a APN 16 11139115 missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 11149378 missense probably benign 0.00
IGL01639:Zc3h7a APN 16 11141708 missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 11145716 missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 11160998 unclassified probably benign
IGL02170:Zc3h7a APN 16 11146395 missense probably benign
IGL02256:Zc3h7a APN 16 11147276 missense probably benign 0.04
IGL02904:Zc3h7a APN 16 11150666 missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 11158594 critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 11162664 nonsense probably null
IGL03201:Zc3h7a APN 16 11156302 critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 11141710 missense probably damaging 1.00
Clement UTSW 16 11164602 nonsense probably null
R0062:Zc3h7a UTSW 16 11139147 missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 11140737 missense probably damaging 1.00
R0376:Zc3h7a UTSW 16 11156202 missense probably benign 0.00
R0545:Zc3h7a UTSW 16 11152333 unclassified probably benign
R0666:Zc3h7a UTSW 16 11156303 unclassified probably benign
R0831:Zc3h7a UTSW 16 11151880 missense probably damaging 0.99
R1127:Zc3h7a UTSW 16 11139075 missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 11162656 missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 11145253 missense possibly damaging 0.67
R1786:Zc3h7a UTSW 16 11150605 nonsense probably null
R1840:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 11147304 missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 11137476 missense probably benign 0.00
R2131:Zc3h7a UTSW 16 11150605 nonsense probably null
R2281:Zc3h7a UTSW 16 11158594 unclassified probably benign
R2399:Zc3h7a UTSW 16 11147401 missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 11156210 missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 11151147 missense probably benign 0.05
R4095:Zc3h7a UTSW 16 11145235 missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 11164644 missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 11150593 critical splice donor site probably null
R4739:Zc3h7a UTSW 16 11141709 missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 11161121 frame shift probably null
R5545:Zc3h7a UTSW 16 11148451 missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 11156186 missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 11164602 nonsense probably null
R5993:Zc3h7a UTSW 16 11150662 missense probably damaging 1.00
R6183:Zc3h7a UTSW 16 11147370 missense possibly damaging 0.81
R6459:Zc3h7a UTSW 16 11153161 missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 11158765 critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 11158967 missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 11145671 missense probably damaging 1.00
R6964:Zc3h7a UTSW 16 11149224 missense probably benign 0.00
R7354:Zc3h7a UTSW 16 11148514 missense probably damaging 1.00
R7667:Zc3h7a UTSW 16 11139026 nonsense probably null
R7742:Zc3h7a UTSW 16 11153161 missense probably benign 0.02
R7780:Zc3h7a UTSW 16 11149251 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGTAAGCAGGGCTGTGACAC -3'
(R):5'- GGGCCATACATTTGTCTTCATG -3'

Sequencing Primer
(F):5'- GCTGTGACACTGCTCTCTGG -3'
(R):5'- GTCTTCATGTATGAAACAGGTATGG -3'
Posted On2015-01-11