Mutagenetix > Incidental Mutations

Incidental Mutation 'R2979:Pros1'

257049

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62913866 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 345 (D345G)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023629
AA Change: D345G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: D345G

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afm	A	G	5: 90,522,163	I48V	probably benign	Het
Arhgef1	A	G	7: 24,907,751	E16G	unknown	Het
Cps1	T	C	1: 67,204,704		probably null	Het
Dnah9	T	C	11: 66,117,588	K804E	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Gm18025	G	T	12: 34,290,971	P41Q	probably damaging	Het
Kdm4c	A	T	4: 74,373,728	R861*	probably null	Het
Klhl2	C	T	8: 64,823,078	V58I	probably damaging	Het
Msl1	G	A	11: 98,800,224	G178E	possibly damaging	Het
Nacad	T	A	11: 6,601,424	Q589L	probably benign	Het
Sh3tc2	A	G	18: 61,989,485	Y439C	probably damaging	Het
Smarcad1	T	A	6: 65,075,011	M376K	probably benign	Het
Srd5a1	T	C	13: 69,600,299	Q127R	probably damaging	Het
Synm	T	G	7: 67,736,260	R551S	probably damaging	Het
Trmt1	A	G	8: 84,696,882	Y301C	probably damaging	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Txnl1	T	C	18: 63,671,620	T268A	probably benign	Het
Zbbx	C	A	3: 75,078,486	E420*	probably null	Het
Zc3h7a	A	T	16: 11,158,973	V153E	probably damaging	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAACCTGTGAACAATTTAATGCTGC -3'
(R):5'- TTGCTCCCACTTGACAATCAG -3'

Sequencing Primer
(F):5'- GACCCTTCTGAATCTCTCAC -3'
(R):5'- CGTTGTTAATAACATTGCCTC -3'

Posted On

2015-01-11