Mutagenetix > Incidental Mutation

Incidental Mutation 'R2980:Astn1'

257052

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R2980 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158189843-158519351 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to T at 158400521 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000193599] [ENSMUST00000194369] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

probably null
Transcript: ENSMUST00000046110

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000170718

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000193042

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000193599

SMART Domains

Protein: ENSMUSP00000141498
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
EGF	101	142	1.1e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000194369

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000195311

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,633,034 (GRCm39)	I236T	probably benign	Het
Alms1	T	C	6: 85,605,817 (GRCm39)	L2489P	probably damaging	Het
BC051665	T	C	13: 60,932,209 (GRCm39)	T127A	probably damaging	Het
Blnk	T	C	19: 40,950,794 (GRCm39)	Y119C	probably damaging	Het
Cd200r3	T	A	16: 44,774,552 (GRCm39)	D188E	probably benign	Het
Ctdnep1	C	A	11: 69,879,497 (GRCm39)	A7D	probably damaging	Het
Ddx4	A	T	13: 112,748,619 (GRCm39)	D452E	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Jak1	T	C	4: 101,036,978 (GRCm39)	I221V	probably damaging	Het
Kremen1	G	GGGT	11: 5,151,794 (GRCm39)		probably benign	Het
Sox21	T	C	14: 118,472,962 (GRCm39)	E29G	probably damaging	Het
Tox4	T	C	14: 52,529,983 (GRCm39)	S548P	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,648 (GRCm39)		probably benign	Het
Ttc23l	G	A	15: 10,537,652 (GRCm39)	S206L	probably benign	Het
Zfy1	T	C	Y: 739,054 (GRCm39)	N51D	unknown	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158,427,889 (GRCm39)	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158,331,883 (GRCm39)	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158,407,897 (GRCm39)	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158,496,201 (GRCm39)	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158,338,724 (GRCm39)	intron	probably benign
IGL02168:Astn1	APN	1	158,436,911 (GRCm39)	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158,491,700 (GRCm39)	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158,338,520 (GRCm39)	splice site	probably benign
IGL02307:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158,329,978 (GRCm39)	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158,332,965 (GRCm39)	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158,516,120 (GRCm39)	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158,439,965 (GRCm39)	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158,496,193 (GRCm39)	splice site	probably benign
IGL03354:Astn1	APN	1	158,516,174 (GRCm39)	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158,424,781 (GRCm39)	missense	probably benign	0.23
PIT4366001:Astn1	UTSW	1	158,424,779 (GRCm39)	missense	probably benign	0.20
R0024:Astn1	UTSW	1	158,511,785 (GRCm39)	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158,407,294 (GRCm39)	splice site	probably benign
R0099:Astn1	UTSW	1	158,329,721 (GRCm39)	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158,516,118 (GRCm39)	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158,337,461 (GRCm39)	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158,427,959 (GRCm39)	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158,299,959 (GRCm39)	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158,337,460 (GRCm39)	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158,338,679 (GRCm39)	nonsense	probably null
R1027:Astn1	UTSW	1	158,407,849 (GRCm39)	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158,427,935 (GRCm39)	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158,329,923 (GRCm39)	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158,407,146 (GRCm39)	splice site	probably benign
R1701:Astn1	UTSW	1	158,331,877 (GRCm39)	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158,331,821 (GRCm39)	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158,429,515 (GRCm39)	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158,332,886 (GRCm39)	splice site	probably null
R1919:Astn1	UTSW	1	158,337,541 (GRCm39)	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158,348,091 (GRCm39)	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158,436,875 (GRCm39)	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158,484,690 (GRCm39)	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158,428,072 (GRCm39)	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158,299,978 (GRCm39)	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158,495,179 (GRCm39)	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158,329,720 (GRCm39)	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158,484,876 (GRCm39)	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158,407,236 (GRCm39)	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158,439,916 (GRCm39)	missense	possibly damaging	0.66
R3713:Astn1	UTSW	1	158,495,102 (GRCm39)	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158,329,630 (GRCm39)	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158,407,227 (GRCm39)	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158,329,602 (GRCm39)	splice site	probably null
R4625:Astn1	UTSW	1	158,407,864 (GRCm39)	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158,329,821 (GRCm39)	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158,440,102 (GRCm39)	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158,407,933 (GRCm39)	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158,427,950 (GRCm39)	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158,429,507 (GRCm39)	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158,337,563 (GRCm39)	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158,491,691 (GRCm39)	nonsense	probably null
R6481:Astn1	UTSW	1	158,440,032 (GRCm39)	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158,338,718 (GRCm39)	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158,440,042 (GRCm39)	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158,491,644 (GRCm39)	nonsense	probably null
R7062:Astn1	UTSW	1	158,516,081 (GRCm39)	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158,400,557 (GRCm39)	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158,491,846 (GRCm39)	splice site	probably null
R7402:Astn1	UTSW	1	158,380,425 (GRCm39)	intron	probably benign
R7412:Astn1	UTSW	1	158,329,919 (GRCm39)	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158,438,352 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,495,208 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,332,956 (GRCm39)	missense	possibly damaging	0.84
R7635:Astn1	UTSW	1	158,495,105 (GRCm39)	nonsense	probably null
R7890:Astn1	UTSW	1	158,407,903 (GRCm39)	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158,429,508 (GRCm39)	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158,424,886 (GRCm39)	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158,516,208 (GRCm39)	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158,331,920 (GRCm39)	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158,436,890 (GRCm39)	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158,436,850 (GRCm39)	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158,329,803 (GRCm39)	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158,484,670 (GRCm39)	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158,491,700 (GRCm39)	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158,348,070 (GRCm39)	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158,496,327 (GRCm39)	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158,338,555 (GRCm39)	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158,511,721 (GRCm39)	missense	probably damaging	1.00
R9683:Astn1	UTSW	1	158,491,619 (GRCm39)	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158,511,666 (GRCm39)	nonsense	probably null
Z1088:Astn1	UTSW	1	158,424,776 (GRCm39)	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158,300,067 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATGGCTGAGTCCCATTTTGC -3'
(R):5'- AGAGCATGTCTGAGTGTTTCC -3'

Sequencing Primer
(F):5'- GCTCTATATAGTAGCAATGCCCTG -3'
(R):5'- CTGTGTTCACCACTCTGAAGG -3'

Posted On

2015-01-11