Incidental Mutation 'R2981:Timeless'
ID257080
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2981 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128248458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 791 (T791A)
Ref Sequence ENSEMBL: ENSMUSP00000100879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245]
Predicted Effect probably benign
Transcript: ENSMUST00000055539
AA Change: T791A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: T791A

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105240
Predicted Effect probably benign
Transcript: ENSMUST00000105242
AA Change: T791A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: T791A

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105244
AA Change: T791A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: T791A

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
AA Change: T791A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: T791A

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,058,631 T163A probably benign Het
Adgrg7 C T 16: 56,750,406 probably null Het
Ahnak C A 19: 9,000,148 Q17K probably damaging Het
Cacna2d3 T C 14: 29,063,918 Y604C probably damaging Het
Carf A T 1: 60,139,232 E268V probably damaging Het
Dmxl2 C A 9: 54,393,702 R2375L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A G 15: 58,564,077 K440E probably damaging Het
Grin2a A T 16: 9,644,223 F682I possibly damaging Het
Irf3 C A 7: 44,998,700 probably null Het
Kif1b C T 4: 149,220,541 probably null Het
Pcdha5 A G 18: 36,961,476 N346S probably damaging Het
Prex2 T A 1: 11,181,962 V1077D probably damaging Het
Rptor T C 11: 119,865,594 L71S probably damaging Het
Trim58 T A 11: 58,651,561 V449D probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vrk1 A G 12: 106,051,793 Y107C probably damaging Het
Yeats2 C T 16: 20,186,301 P400S probably damaging Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 splice site probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 splice site probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7513:Timeless UTSW 10 128249530 missense probably damaging 0.99
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
R8220:Timeless UTSW 10 128246396 missense probably damaging 0.98
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCAGCAGGCAGGTTGAGG -3'
(R):5'- CATGAGACTACGCCCTTGTCT -3'

Sequencing Primer
(F):5'- CAGGTTGAGGAAGACGCATG -3'
(R):5'- GACTACGCCCTTGTCTCAGAAG -3'
Posted On2015-01-11