Incidental Mutation 'R2981:Vrk1'
ID257083
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R2981 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106051793 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 107 (Y107C)
Ref Sequence ENSEMBL: ENSMUSP00000152721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
Predicted Effect probably damaging
Transcript: ENSMUST00000021539
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115
AA Change: Y107C

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072040
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115
AA Change: Y107C

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085026
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115
AA Change: Y107C

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220629
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221312
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,058,631 T163A probably benign Het
Adgrg7 C T 16: 56,750,406 probably null Het
Ahnak C A 19: 9,000,148 Q17K probably damaging Het
Cacna2d3 T C 14: 29,063,918 Y604C probably damaging Het
Carf A T 1: 60,139,232 E268V probably damaging Het
Dmxl2 C A 9: 54,393,702 R2375L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A G 15: 58,564,077 K440E probably damaging Het
Grin2a A T 16: 9,644,223 F682I possibly damaging Het
Irf3 C A 7: 44,998,700 probably null Het
Kif1b C T 4: 149,220,541 probably null Het
Pcdha5 A G 18: 36,961,476 N346S probably damaging Het
Prex2 T A 1: 11,181,962 V1077D probably damaging Het
Rptor T C 11: 119,865,594 L71S probably damaging Het
Timeless A G 10: 128,248,458 T791A probably benign Het
Trim58 T A 11: 58,651,561 V449D probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Yeats2 C T 16: 20,186,301 P400S probably damaging Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0332:Vrk1 UTSW 12 106058625 missense probably benign 0.05
R0790:Vrk1 UTSW 12 106070624 missense probably benign
R1897:Vrk1 UTSW 12 106036540 splice site probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106057972 missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106051828 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
R8154:Vrk1 UTSW 12 106070534 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCAGTTTCAAGATAGGTAACAGC -3'
(R):5'- TTAACAGGCCCCTGACACTG -3'

Sequencing Primer
(F):5'- TTTCAAGATAGGTAACAGCAGGGTG -3'
(R):5'- CACTGTGGTGTACTGAGAACAAC -3'
Posted On2015-01-11