Mutagenetix > Incidental Mutation

Incidental Mutation 'R2981:Grin2a'

257088

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

R2981 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9644223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 682 (F682I)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: F682I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: F682I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: F682I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: F682I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: F682I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: F682I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 90,058,631 (GRCm38)	T163A	probably benign	Het
Adgrg7	C	T	16: 56,750,406 (GRCm38)		probably null	Het
Ahnak	C	A	19: 9,000,148 (GRCm38)	Q17K	probably damaging	Het
Cacna2d3	T	C	14: 29,063,918 (GRCm38)	Y604C	probably damaging	Het
Carf	A	T	1: 60,139,232 (GRCm38)	E268V	probably damaging	Het
Dmxl2	C	A	9: 54,393,702 (GRCm38)	R2375L	probably damaging	Het
Fabp3	C	T	4: 130,312,387 (GRCm38)	T57I	probably benign	Het
Fer1l6	A	G	15: 58,564,077 (GRCm38)	K440E	probably damaging	Het
Irf3	C	A	7: 44,998,700 (GRCm38)		probably null	Het
Kif1b	C	T	4: 149,220,541 (GRCm38)		probably null	Het
Pcdha5	A	G	18: 36,961,476 (GRCm38)	N346S	probably damaging	Het
Prex2	T	A	1: 11,181,962 (GRCm38)	V1077D	probably damaging	Het
Rptor	T	C	11: 119,865,594 (GRCm38)	L71S	probably damaging	Het
Timeless	A	G	10: 128,248,458 (GRCm38)	T791A	probably benign	Het
Trim58	T	A	11: 58,651,561 (GRCm38)	V449D	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562 (GRCm38)		probably benign	Het
Ttc23l	G	A	15: 10,537,566 (GRCm38)	S206L	probably benign	Het
Vrk1	A	G	12: 106,051,793 (GRCm38)	Y107C	probably damaging	Het
Yeats2	C	T	16: 20,186,301 (GRCm38)	P400S	probably damaging	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9,644,130 (GRCm38)	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9,669,840 (GRCm38)	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9,585,108 (GRCm38)	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9,644,199 (GRCm38)	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9,585,096 (GRCm38)	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9,669,807 (GRCm38)	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9,669,807 (GRCm38)	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9,994,821 (GRCm38)	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9,994,821 (GRCm38)	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9,579,173 (GRCm38)	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9,579,585 (GRCm38)	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9,992,472 (GRCm38)	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9,992,472 (GRCm38)	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9,579,611 (GRCm38)	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9,663,603 (GRCm38)	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9,579,203 (GRCm38)	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9,707,715 (GRCm38)	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9,663,330 (GRCm38)	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9,992,395 (GRCm38)	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9,644,243 (GRCm38)	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9,669,744 (GRCm38)	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9,663,235 (GRCm38)	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9,761,965 (GRCm38)	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9,761,965 (GRCm38)	missense	possibly damaging	0.73
R4197:Grin2a	UTSW	16	9,761,967 (GRCm38)	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9,653,589 (GRCm38)	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9,663,512 (GRCm38)	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9,657,706 (GRCm38)	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9,669,823 (GRCm38)	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9,707,717 (GRCm38)	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9,992,226 (GRCm38)	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9,761,526 (GRCm38)	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9,761,905 (GRCm38)	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9,761,907 (GRCm38)	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9,579,540 (GRCm38)	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9,653,449 (GRCm38)	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9,761,775 (GRCm38)	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9,579,334 (GRCm38)	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9,669,840 (GRCm38)	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9,663,228 (GRCm38)	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9,579,424 (GRCm38)	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9,579,265 (GRCm38)	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9,579,122 (GRCm38)	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9,992,463 (GRCm38)	missense	probably benign
R7990:Grin2a	UTSW	16	9,579,176 (GRCm38)	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9,663,518 (GRCm38)	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9,663,549 (GRCm38)	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9,585,225 (GRCm38)	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9,579,548 (GRCm38)	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9,669,894 (GRCm38)	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9,579,322 (GRCm38)	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9,579,607 (GRCm38)	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9,653,401 (GRCm38)	nonsense	probably null
R9786:Grin2a	UTSW	16	9,653,602 (GRCm38)	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9,663,199 (GRCm38)	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9,663,577 (GRCm38)	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AGCCATGCAGAGTCTGTTTCTG -3'
(R):5'- GCCATCTTAGAGATCGCAGACC -3'

Sequencing Primer
(F):5'- CTGTCAGATTTAAAGACCCGATGTC -3'
(R):5'- TCTTAGAGATCGCAGACCCATGG -3'

Posted On

2015-01-11