Incidental Mutation 'R2982:Olfr1016'
ID257093
Institutional Source Beutler Lab
Gene Symbol Olfr1016
Ensembl Gene ENSMUSG00000075209
Gene Nameolfactory receptor 1016
SynonymsMOR213-9, GA_x6K02T2Q125-47278889-47277960
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2982 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85797618-85802544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85799350 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 307 (I307F)
Ref Sequence ENSEMBL: ENSMUSP00000149631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099915] [ENSMUST00000216425] [ENSMUST00000217410]
Predicted Effect probably benign
Transcript: ENSMUST00000099915
AA Change: I307F

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097499
Gene: ENSMUSG00000075209
AA Change: I307F

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 9.8e-51 PFAM
Pfam:7tm_1 40 289 8.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216425
AA Change: I307F

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000217410
AA Change: I307F

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr1 T C 8: 25,558,211 F106L probably benign Het
Hpse2 T A 19: 43,384,743 D149V probably null Het
Hsd3b5 T A 3: 98,619,800 D110V possibly damaging Het
Klhl42 T C 6: 147,091,616 Y29H probably damaging Het
Klk1 G A 7: 44,229,439 C117Y probably damaging Het
Mfhas1 T C 8: 35,591,115 Y915H probably benign Het
Msantd2 A G 9: 37,523,343 Q293R probably damaging Het
Olfr1352 T C 10: 78,984,440 S217P probably damaging Het
Olfr364-ps1 G T 2: 37,146,381 M56I probably damaging Het
Osgin1 T G 8: 119,442,535 L35R probably damaging Het
Rufy1 C T 11: 50,419,708 R210K possibly damaging Het
Spats2 T C 15: 99,211,046 S426P probably benign Het
Tnc T A 4: 64,020,519 I28F possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp512 C A 5: 31,476,778 probably null Het
Other mutations in Olfr1016
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Olfr1016 APN 2 85799602 missense probably benign 0.01
IGL02676:Olfr1016 APN 2 85799590 missense possibly damaging 0.55
R0279:Olfr1016 UTSW 2 85799535 missense possibly damaging 0.80
R3708:Olfr1016 UTSW 2 85799998 missense probably benign 0.17
R4014:Olfr1016 UTSW 2 85799476 missense probably damaging 0.99
R4193:Olfr1016 UTSW 2 85800018 missense probably benign 0.39
R4593:Olfr1016 UTSW 2 85799664 missense probably damaging 1.00
R4772:Olfr1016 UTSW 2 85799994 missense probably damaging 1.00
R4816:Olfr1016 UTSW 2 85800047 missense probably benign
R4864:Olfr1016 UTSW 2 85799689 missense probably damaging 1.00
R5382:Olfr1016 UTSW 2 85800148 missense probably damaging 1.00
R5886:Olfr1016 UTSW 2 85799803 missense probably damaging 0.96
R6004:Olfr1016 UTSW 2 85799382 missense probably damaging 1.00
R7833:Olfr1016 UTSW 2 85799949 missense probably benign 0.20
R7916:Olfr1016 UTSW 2 85799949 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGACATAACACAAGCCTGTACATG -3'
(R):5'- GCATGAAGGCCTTCTCTACC -3'

Sequencing Primer
(F):5'- GCCTGTACATGTTAAGTATTACCAC -3'
(R):5'- ATCTCTGTGACTTTGTACTATGGC -3'
Posted On2015-01-11