Incidental Mutation 'R2982:Klhl42'
ID257098
Institutional Source Beutler Lab
Gene Symbol Klhl42
Ensembl Gene ENSMUSG00000040102
Gene Namekelch-like 42
SynonymsKlhdc5, C230080I20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2982 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location147091379-147112778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147091616 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 29 (Y29H)
Ref Sequence ENSEMBL: ENSMUSP00000042558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036003] [ENSMUST00000100780] [ENSMUST00000123367]
Predicted Effect probably damaging
Transcript: ENSMUST00000036003
AA Change: Y29H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042558
Gene: ENSMUSG00000040102
AA Change: Y29H

DomainStartEndE-ValueType
BTB 5 145 1.14e-1 SMART
low complexity region 151 164 N/A INTRINSIC
Kelch 242 289 1.79e-5 SMART
Kelch 290 332 1.25e-9 SMART
Kelch 333 379 1.56e1 SMART
Blast:Kelch 380 437 3e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100780
SMART Domains Protein: ENSMUSP00000098343
Gene: ENSMUSG00000072662

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 5.4e-34 SMART
low complexity region 263 274 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123367
SMART Domains Protein: ENSMUSP00000144765
Gene: ENSMUSG00000072662

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 9.4e-40 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr1 T C 8: 25,558,211 F106L probably benign Het
Hpse2 T A 19: 43,384,743 D149V probably null Het
Hsd3b5 T A 3: 98,619,800 D110V possibly damaging Het
Klk1 G A 7: 44,229,439 C117Y probably damaging Het
Mfhas1 T C 8: 35,591,115 Y915H probably benign Het
Msantd2 A G 9: 37,523,343 Q293R probably damaging Het
Olfr1016 T A 2: 85,799,350 I307F probably benign Het
Olfr1352 T C 10: 78,984,440 S217P probably damaging Het
Olfr364-ps1 G T 2: 37,146,381 M56I probably damaging Het
Osgin1 T G 8: 119,442,535 L35R probably damaging Het
Rufy1 C T 11: 50,419,708 R210K possibly damaging Het
Spats2 T C 15: 99,211,046 S426P probably benign Het
Tnc T A 4: 64,020,519 I28F possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp512 C A 5: 31,476,778 probably null Het
Other mutations in Klhl42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Klhl42 APN 6 147101733 missense probably damaging 1.00
IGL01401:Klhl42 APN 6 147107743 missense probably benign 0.03
IGL02590:Klhl42 APN 6 147092312 missense probably damaging 0.97
R0045:Klhl42 UTSW 6 147092168 missense probably benign
R1066:Klhl42 UTSW 6 147107899 missense probably benign
R1920:Klhl42 UTSW 6 147107929 missense probably damaging 1.00
R1951:Klhl42 UTSW 6 147091823 missense probably damaging 0.99
R2017:Klhl42 UTSW 6 147107793 missense probably benign 0.04
R2021:Klhl42 UTSW 6 147091896 missense possibly damaging 0.59
R2065:Klhl42 UTSW 6 147101663 missense probably damaging 1.00
R2128:Klhl42 UTSW 6 147101753 missense probably benign 0.00
R3415:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3416:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3417:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R4450:Klhl42 UTSW 6 147091671 missense probably benign 0.16
R4967:Klhl42 UTSW 6 147108004 missense possibly damaging 0.77
R5342:Klhl42 UTSW 6 147092286 missense possibly damaging 0.86
R5556:Klhl42 UTSW 6 147108112 missense probably benign 0.00
R6269:Klhl42 UTSW 6 147092307 missense probably damaging 1.00
R7375:Klhl42 UTSW 6 147092040 missense probably benign
R7769:Klhl42 UTSW 6 147091860 missense possibly damaging 0.95
R7848:Klhl42 UTSW 6 147108100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAGAGAGGCCGTTTACTCG -3'
(R):5'- CATCTCGGACAGCACACTAG -3'

Sequencing Primer
(F):5'- TACTCGGAGGGCGTGTGAC -3'
(R):5'- GGACAGCACACTAGCCTCG -3'
Posted On2015-01-11