Incidental Mutation 'R2982:Klk1'
ID257099
Institutional Source Beutler Lab
Gene Symbol Klk1
Ensembl Gene ENSMUSG00000063903
Gene Namekallikrein 1
SynonymsKlk6, mGk-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2982 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44225360-44229618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44229439 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 117 (C117Y)
Ref Sequence ENSEMBL: ENSMUSP00000146057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037220] [ENSMUST00000075162] [ENSMUST00000206144] [ENSMUST00000206366] [ENSMUST00000206686]
Predicted Effect probably benign
Transcript: ENSMUST00000037220
SMART Domains Protein: ENSMUSP00000048665
Gene: ENSMUSG00000038782

DomainStartEndE-ValueType
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075162
AA Change: C219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074659
Gene: ENSMUSG00000063903
AA Change: C219Y

DomainStartEndE-ValueType
Tryp_SPc 24 253 7.26e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205329
Predicted Effect probably damaging
Transcript: ENSMUST00000206144
AA Change: C117Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206366
Predicted Effect probably benign
Transcript: ENSMUST00000206686
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein are unable to generate significant levels of kinins in most tissues, develop cardiovascular abnormalities and exhibit hypercalciuria of renal origin. This gene is located in a cluster of several related kallikrein genes on chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr1 T C 8: 25,558,211 F106L probably benign Het
Hpse2 T A 19: 43,384,743 D149V probably null Het
Hsd3b5 T A 3: 98,619,800 D110V possibly damaging Het
Klhl42 T C 6: 147,091,616 Y29H probably damaging Het
Mfhas1 T C 8: 35,591,115 Y915H probably benign Het
Msantd2 A G 9: 37,523,343 Q293R probably damaging Het
Olfr1016 T A 2: 85,799,350 I307F probably benign Het
Olfr1352 T C 10: 78,984,440 S217P probably damaging Het
Olfr364-ps1 G T 2: 37,146,381 M56I probably damaging Het
Osgin1 T G 8: 119,442,535 L35R probably damaging Het
Rufy1 C T 11: 50,419,708 R210K possibly damaging Het
Spats2 T C 15: 99,211,046 S426P probably benign Het
Tnc T A 4: 64,020,519 I28F possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp512 C A 5: 31,476,778 probably null Het
Other mutations in Klk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Klk1 APN 7 44228596 missense probably damaging 0.98
IGL01788:Klk1 APN 7 44228983 missense probably benign 0.00
R0011:Klk1 UTSW 7 44229535 missense probably benign 0.03
R0184:Klk1 UTSW 7 44228749 missense possibly damaging 0.50
R0853:Klk1 UTSW 7 44221498 unclassified probably benign
R0925:Klk1 UTSW 7 44228816 critical splice donor site probably null
R2044:Klk1 UTSW 7 44229034 missense possibly damaging 0.95
R2518:Klk1 UTSW 7 44220737 unclassified probably null
R3962:Klk1 UTSW 7 44229549 missense possibly damaging 0.87
R4041:Klk1 UTSW 7 44229562 missense probably damaging 1.00
R4067:Klk1 UTSW 7 44227544 nonsense probably null
R4385:Klk1 UTSW 7 44228569 missense probably benign 0.12
R4901:Klk1 UTSW 7 44228715 missense probably damaging 0.99
R5256:Klk1 UTSW 7 44221561 unclassified probably benign
R5580:Klk1 UTSW 7 44228814 missense probably benign 0.00
R5595:Klk1 UTSW 7 44228737 unclassified probably null
R6818:Klk1 UTSW 7 44229459 missense probably damaging 1.00
R7100:Klk1 UTSW 7 44229424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGGCTTAGGGGACTGTC -3'
(R):5'- GAACTCATTTGCTGCATGGTG -3'

Sequencing Primer
(F):5'- TGACCCTGGAAAAGATGGCCTC -3'
(R):5'- GGGCTTTATTGAGAACATGGGAC -3'
Posted On2015-01-11