Incidental Mutation 'R2982:Rufy1'
ID257105
Institutional Source Beutler Lab
Gene Symbol Rufy1
Ensembl Gene ENSMUSG00000020375
Gene NameRUN and FYVE domain containing 1
SynonymsZFYVE12, 3000002E04Rik, Rabip4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R2982 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50389286-50431125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50419708 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 210 (R210K)
Ref Sequence ENSEMBL: ENSMUSP00000020643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020643
AA Change: R210K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375
AA Change: R210K

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129304
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr1 T C 8: 25,558,211 F106L probably benign Het
Hpse2 T A 19: 43,384,743 D149V probably null Het
Hsd3b5 T A 3: 98,619,800 D110V possibly damaging Het
Klhl42 T C 6: 147,091,616 Y29H probably damaging Het
Klk1 G A 7: 44,229,439 C117Y probably damaging Het
Mfhas1 T C 8: 35,591,115 Y915H probably benign Het
Msantd2 A G 9: 37,523,343 Q293R probably damaging Het
Olfr1016 T A 2: 85,799,350 I307F probably benign Het
Olfr1352 T C 10: 78,984,440 S217P probably damaging Het
Olfr364-ps1 G T 2: 37,146,381 M56I probably damaging Het
Osgin1 T G 8: 119,442,535 L35R probably damaging Het
Spats2 T C 15: 99,211,046 S426P probably benign Het
Tnc T A 4: 64,020,519 I28F possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp512 C A 5: 31,476,778 probably null Het
Other mutations in Rufy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Rufy1 APN 11 50392023 missense probably damaging 1.00
IGL01640:Rufy1 APN 11 50390378 unclassified probably benign
IGL01829:Rufy1 APN 11 50416244 nonsense probably null
IGL02559:Rufy1 APN 11 50420483 missense probably damaging 1.00
IGL03409:Rufy1 APN 11 50406483 missense probably benign 0.00
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0193:Rufy1 UTSW 11 50389852 missense probably benign 0.12
R1028:Rufy1 UTSW 11 50414598 intron probably null
R1591:Rufy1 UTSW 11 50394928 missense probably damaging 1.00
R1818:Rufy1 UTSW 11 50414572 missense probably benign 0.43
R1952:Rufy1 UTSW 11 50406406 missense probably benign 0.01
R2228:Rufy1 UTSW 11 50397784 splice site probably null
R4837:Rufy1 UTSW 11 50401493 missense probably damaging 0.96
R4874:Rufy1 UTSW 11 50406450 missense possibly damaging 0.80
R4959:Rufy1 UTSW 11 50401488 missense probably benign
R4968:Rufy1 UTSW 11 50410607 missense probably benign 0.01
R5204:Rufy1 UTSW 11 50406434 missense probably damaging 1.00
R5426:Rufy1 UTSW 11 50421734 missense probably damaging 1.00
R5966:Rufy1 UTSW 11 50401488 missense probably benign
R6129:Rufy1 UTSW 11 50417248 missense probably damaging 0.99
R6930:Rufy1 UTSW 11 50398380 missense probably benign 0.05
R7073:Rufy1 UTSW 11 50404463 missense probably benign 0.05
R7462:Rufy1 UTSW 11 50407828 missense possibly damaging 0.93
R7646:Rufy1 UTSW 11 50410609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGAGCTGCGTGTTGTC -3'
(R):5'- AAGAGCCTGTGGTACAAAATGC -3'

Sequencing Primer
(F):5'- CTGCGTGTTGTCTGTGATACC -3'
(R):5'- ACCTAAGTTGCACAGCGTG -3'
Posted On2015-01-11