Incidental Mutation 'R2982:Hpse2'
ID257111
Institutional Source Beutler Lab
Gene Symbol Hpse2
Ensembl Gene ENSMUSG00000074852
Gene Nameheparanase 2
SynonymsLOC381226
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R2982 (G1)
Quality Score199
Status Not validated
Chromosome19
Chromosomal Location42788947-43388311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43384743 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 149 (D149V)
Ref Sequence ENSEMBL: ENSMUSP00000097026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099428]
Predicted Effect probably null
Transcript: ENSMUST00000099428
AA Change: D149V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097026
Gene: ENSMUSG00000074852
AA Change: D149V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Glyco_hydro_79n 168 408 6.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heparanase enzyme. The encoded protein is a endoglycosidase that degrades heparin sulfate proteoglycans located on the extracellular matrix and cell surface. This protein may be involved in biological processes involving remodeling of the extracellular matrix including angiogenesis and tumor progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit growth retardation, a distended urinary bladder, abnormal voiding behavior, proteinuria, renal dysfunction and malnutrition, reduced cell proliferation, urinary bladder fibrosis, and lethality within one month of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr1 T C 8: 25,558,211 F106L probably benign Het
Hsd3b5 T A 3: 98,619,800 D110V possibly damaging Het
Klhl42 T C 6: 147,091,616 Y29H probably damaging Het
Klk1 G A 7: 44,229,439 C117Y probably damaging Het
Mfhas1 T C 8: 35,591,115 Y915H probably benign Het
Msantd2 A G 9: 37,523,343 Q293R probably damaging Het
Olfr1016 T A 2: 85,799,350 I307F probably benign Het
Olfr1352 T C 10: 78,984,440 S217P probably damaging Het
Olfr364-ps1 G T 2: 37,146,381 M56I probably damaging Het
Osgin1 T G 8: 119,442,535 L35R probably damaging Het
Rufy1 C T 11: 50,419,708 R210K possibly damaging Het
Spats2 T C 15: 99,211,046 S426P probably benign Het
Tnc T A 4: 64,020,519 I28F possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp512 C A 5: 31,476,778 probably null Het
Other mutations in Hpse2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Hpse2 APN 19 43384789 missense probably benign
IGL02315:Hpse2 APN 19 42966947 splice site probably benign
IGL02324:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02328:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02388:Hpse2 APN 19 43294253 missense probably damaging 1.00
IGL02977:Hpse2 APN 19 42789122 splice site probably benign
R0147:Hpse2 UTSW 19 42931660 splice site probably null
R0148:Hpse2 UTSW 19 42931660 splice site probably null
R0472:Hpse2 UTSW 19 43013163 missense probably damaging 0.99
R0892:Hpse2 UTSW 19 43388146 missense probably benign 0.31
R1033:Hpse2 UTSW 19 42913199 missense probably benign 0.41
R1242:Hpse2 UTSW 19 42966977 missense probably benign 0.00
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1611:Hpse2 UTSW 19 42789065 missense probably damaging 1.00
R2382:Hpse2 UTSW 19 42931622 missense probably benign 0.04
R2496:Hpse2 UTSW 19 43013043 critical splice donor site probably null
R4056:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4057:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4434:Hpse2 UTSW 19 43294269 missense probably benign 0.00
R4762:Hpse2 UTSW 19 42789071 missense possibly damaging 0.52
R4856:Hpse2 UTSW 19 42788957 missense probably damaging 1.00
R4886:Hpse2 UTSW 19 43384764 missense probably damaging 1.00
R5018:Hpse2 UTSW 19 43384824 missense possibly damaging 0.57
R6289:Hpse2 UTSW 19 42788979 missense probably null 1.00
R6382:Hpse2 UTSW 19 43388202 missense possibly damaging 0.93
R6805:Hpse2 UTSW 19 43294321 nonsense probably null
R7528:Hpse2 UTSW 19 42813024 missense probably damaging 1.00
R7793:Hpse2 UTSW 19 43388070 missense probably damaging 1.00
R7960:Hpse2 UTSW 19 42913214 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAATGAACCCTAGCCTGCTG -3'
(R):5'- CTACCTGACCAGTGCTCTCTAG -3'

Sequencing Primer
(F):5'- CTGCTTCTAGTTTTTCAGGGGAAC -3'
(R):5'- AGCCTTCTCCCGGGATC -3'
Posted On2015-01-11