Incidental Mutation 'R2983:Vmn1r81'
ID257121
Institutional Source Beutler Lab
Gene Symbol Vmn1r81
Ensembl Gene ENSMUSG00000115027
Gene Namevomeronasal 1 receptor 81
SynonymsV1rg9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R2983 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12247241-12268269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12260669 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 4 (T4I)
Ref Sequence ENSEMBL: ENSMUSP00000153780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086232] [ENSMUST00000227080] [ENSMUST00000227973] [ENSMUST00000228482] [ENSMUST00000228764]
Predicted Effect probably benign
Transcript: ENSMUST00000086232
AA Change: T4I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083409
Gene: ENSMUSG00000115027
AA Change: T4I

DomainStartEndE-ValueType
Pfam:TAS2R 3 301 5.4e-12 PFAM
Pfam:V1R 34 299 6.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227080
AA Change: T4I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000227973
AA Change: T4I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228482
AA Change: T4I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000228764
AA Change: T4I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,623,214 D347G probably damaging Het
Brwd1 T C 16: 96,066,574 K124E probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dlec1 T C 9: 119,146,173 V1607A probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Flnb T A 14: 7,882,250 V317E probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15448 A T 7: 3,821,575 S503T probably damaging Het
Kmt2c AGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 5: 25,315,757 probably benign Het
Ncs1 C T 2: 31,284,696 T144I probably damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr180 T A 16: 58,916,567 T25S probably benign Het
Prkcd G A 14: 30,599,478 S552L probably damaging Het
Rad54l2 A G 9: 106,700,590 V1044A probably benign Het
Rasal1 A G 5: 120,654,862 H60R probably benign Het
Rccd1 G A 7: 80,320,528 Q114* probably null Het
Speg T C 1: 75,384,930 V90A possibly damaging Het
St8sia1 A G 6: 142,963,629 V47A probably damaging Het
Tex264 A G 9: 106,682,097 I10T unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Vmn1r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vmn1r81 APN 7 12260505 missense probably damaging 1.00
IGL02086:Vmn1r81 APN 7 12259865 missense possibly damaging 0.82
IGL02751:Vmn1r81 APN 7 12260447 missense probably damaging 1.00
IGL02879:Vmn1r81 APN 7 12260392 missense probably benign 0.20
IGL03358:Vmn1r81 APN 7 12260305 missense possibly damaging 0.57
PIT4305001:Vmn1r81 UTSW 7 12260663 missense probably benign 0.01
R0359:Vmn1r81 UTSW 7 12259950 missense probably damaging 1.00
R1615:Vmn1r81 UTSW 7 12260514 missense probably damaging 1.00
R1938:Vmn1r81 UTSW 7 12260662 missense possibly damaging 0.67
R2967:Vmn1r81 UTSW 7 12260037 missense probably damaging 0.99
R4549:Vmn1r81 UTSW 7 12259822 missense probably damaging 0.99
R5099:Vmn1r81 UTSW 7 12260321 missense possibly damaging 0.86
R5326:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R5542:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R6010:Vmn1r81 UTSW 7 12260422 missense possibly damaging 0.88
R6630:Vmn1r81 UTSW 7 12260657 nonsense probably null
R6724:Vmn1r81 UTSW 7 12260672 missense probably damaging 1.00
R6754:Vmn1r81 UTSW 7 12259847 missense probably damaging 0.98
R8198:Vmn1r81 UTSW 7 12259955 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCCTTTTGAGATTAGAGACAAGC -3'
(R):5'- TAGATCTGCCTGCCTCTGTG -3'

Sequencing Primer
(F):5'- CAGTTGGATAAAGTCAAGTGCTC -3'
(R):5'- CCATTAATGTGTACACCATGACATC -3'
Posted On2015-01-11