Mutagenetix > Incidental Mutation

Incidental Mutation 'R2983:Rad54l2'

257125

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2983 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106700590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1044 (V1044A)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046502
AA Change: V1044A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: V1044A

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,623,214	D347G	probably damaging	Het
Brwd1	T	C	16: 96,066,574	K124E	probably damaging	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dlec1	T	C	9: 119,146,173	V1607A	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Flnb	T	A	14: 7,882,250	V317E	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm15448	A	T	7: 3,821,575	S503T	probably damaging	Het
Kmt2c	AGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTG	AGCTGCTGCTGCTGCTG	5: 25,315,757		probably benign	Het
Ncs1	C	T	2: 31,284,696	T144I	probably damaging	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Olfr180	T	A	16: 58,916,567	T25S	probably benign	Het
Prkcd	G	A	14: 30,599,478	S552L	probably damaging	Het
Rasal1	A	G	5: 120,654,862	H60R	probably benign	Het
Rccd1	G	A	7: 80,320,528	Q114*	probably null	Het
Speg	T	C	1: 75,384,930	V90A	possibly damaging	Het
St8sia1	A	G	6: 142,963,629	V47A	probably damaging	Het
Tex264	A	G	9: 106,682,097	I10T	unknown	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn1r81	G	A	7: 12,260,669	T4I	probably benign	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGGCTCACAACCATCTGT -3'
(R):5'- GGTGACAGCTACGGTGACAG -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGAG -3'
(R):5'- GGGCATGACAACCCCTAGTAG -3'

Posted On

2015-01-11