Incidental Mutation 'R2994:Oprk1'
ID257134
Institutional Source Beutler Lab
Gene Symbol Oprk1
Ensembl Gene ENSMUSG00000025905
Gene Nameopioid receptor, kappa 1
SynonymsR21, KOR-1, Oprk2
MMRRC Submission 040529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2994 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location5588466-5606131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5602732 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 364 (V364A)
Ref Sequence ENSEMBL: ENSMUSP00000125105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027038] [ENSMUST00000160339] [ENSMUST00000160777]
Predicted Effect probably benign
Transcript: ENSMUST00000027038
AA Change: V364A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027038
Gene: ENSMUSG00000025905
AA Change: V364A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159083
Predicted Effect probably benign
Transcript: ENSMUST00000160339
AA Change: V364A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124030
Gene: ENSMUSG00000025905
AA Change: V364A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 284 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-60 PFAM
Pfam:7TM_GPCR_Srv 78 345 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160777
AA Change: V364A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125105
Gene: ENSMUSG00000025905
AA Change: V364A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired response to morphine and an opioid agonist, abnormal pain threshold, and increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,564 S577P probably damaging Het
Agrn T C 4: 156,167,328 T1826A possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Btnl6 C A 17: 34,515,524 R88I possibly damaging Het
Cfap52 T A 11: 67,939,791 Y281F probably benign Het
CK137956 T C 4: 127,951,507 T148A probably benign Het
Fpr3 C T 17: 17,970,868 Q134* probably null Het
Gbp4 A T 5: 105,137,020 M1K probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Nedd4 A G 9: 72,730,903 D440G probably benign Het
Nlgn1 C T 3: 25,435,998 D522N probably damaging Het
Olfr395 T C 11: 73,906,715 Y259C probably damaging Het
Olfr73 A G 2: 88,034,957 Y61H probably damaging Het
Polr1e T C 4: 45,027,473 probably null Het
Psmd11 T C 11: 80,460,667 Y239H probably damaging Het
Ripor2 A T 13: 24,701,627 D576V probably damaging Het
Rundc3a C T 11: 102,400,663 T327I probably damaging Het
Sh3rf1 A G 8: 61,372,575 T535A probably benign Het
Slc13a2 T A 11: 78,404,737 E101V probably damaging Het
Tg A T 15: 66,681,953 T406S probably benign Het
Tjp2 T C 19: 24,112,851 E609G probably damaging Het
Zfp459 G A 13: 67,408,734 P77S possibly damaging Het
Zfp612 A G 8: 110,089,417 K380E probably damaging Het
Zfp629 T C 7: 127,611,056 E527G probably damaging Het
Other mutations in Oprk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Oprk1 APN 1 5598905 missense probably damaging 0.99
IGL02049:Oprk1 APN 1 5598844 missense probably damaging 1.00
IGL02076:Oprk1 APN 1 5602289 missense probably damaging 1.00
IGL02265:Oprk1 APN 1 5602648 missense probably damaging 1.00
IGL02294:Oprk1 APN 1 5602387 missense probably damaging 1.00
IGL02584:Oprk1 APN 1 5598604 missense probably damaging 1.00
IGL03164:Oprk1 APN 1 5598864 missense probably damaging 1.00
R0295:Oprk1 UTSW 1 5598850 missense possibly damaging 0.78
R1209:Oprk1 UTSW 1 5602261 missense probably benign 0.00
R1420:Oprk1 UTSW 1 5602321 missense probably damaging 1.00
R3876:Oprk1 UTSW 1 5602661 nonsense probably null
R4026:Oprk1 UTSW 1 5598685 missense probably benign 0.04
R4096:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4097:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4475:Oprk1 UTSW 1 5602601 nonsense probably null
R5177:Oprk1 UTSW 1 5602674 missense probably damaging 1.00
R5223:Oprk1 UTSW 1 5589296 missense probably benign 0.30
R6397:Oprk1 UTSW 1 5598748 missense probably damaging 1.00
R6647:Oprk1 UTSW 1 5602284 missense probably damaging 1.00
R7169:Oprk1 UTSW 1 5589081 missense probably benign
R7170:Oprk1 UTSW 1 5602396 missense probably damaging 1.00
R8186:Oprk1 UTSW 1 5602317 missense probably benign 0.16
Z1176:Oprk1 UTSW 1 5602702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTATCCTGGTGGAGGCTC -3'
(R):5'- CTAGATCACTAATGTGCCCTGC -3'

Sequencing Primer
(F):5'- TCTGGGAAGCACCTCCCAC -3'
(R):5'- GCCCTGCACCTTAATATTTCAGAG -3'
Posted On2015-01-11