Incidental Mutation 'R2994:CK137956'
ID257140
Institutional Source Beutler Lab
Gene Symbol CK137956
Ensembl Gene ENSMUSG00000028813
Gene NamecDNA sequence CK137956
Synonyms
MMRRC Submission 040529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2994 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127927592-127970951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127951507 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 148 (T148A)
Ref Sequence ENSEMBL: ENSMUSP00000030614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030614]
Predicted Effect probably benign
Transcript: ENSMUST00000030614
AA Change: T148A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030614
Gene: ENSMUSG00000028813
AA Change: T148A

DomainStartEndE-ValueType
Pfam:DUF4688 197 596 3.8e-249 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,564 S577P probably damaging Het
Agrn T C 4: 156,167,328 T1826A possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Btnl6 C A 17: 34,515,524 R88I possibly damaging Het
Cfap52 T A 11: 67,939,791 Y281F probably benign Het
Fpr3 C T 17: 17,970,868 Q134* probably null Het
Gbp4 A T 5: 105,137,020 M1K probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Nedd4 A G 9: 72,730,903 D440G probably benign Het
Nlgn1 C T 3: 25,435,998 D522N probably damaging Het
Olfr395 T C 11: 73,906,715 Y259C probably damaging Het
Olfr73 A G 2: 88,034,957 Y61H probably damaging Het
Oprk1 T C 1: 5,602,732 V364A probably benign Het
Polr1e T C 4: 45,027,473 probably null Het
Psmd11 T C 11: 80,460,667 Y239H probably damaging Het
Ripor2 A T 13: 24,701,627 D576V probably damaging Het
Rundc3a C T 11: 102,400,663 T327I probably damaging Het
Sh3rf1 A G 8: 61,372,575 T535A probably benign Het
Slc13a2 T A 11: 78,404,737 E101V probably damaging Het
Tg A T 15: 66,681,953 T406S probably benign Het
Tjp2 T C 19: 24,112,851 E609G probably damaging Het
Zfp459 G A 13: 67,408,734 P77S possibly damaging Het
Zfp612 A G 8: 110,089,417 K380E probably damaging Het
Zfp629 T C 7: 127,611,056 E527G probably damaging Het
Other mutations in CK137956
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:CK137956 APN 4 127935850 missense probably benign
IGL01365:CK137956 APN 4 127951342 missense probably benign 0.01
IGL01563:CK137956 APN 4 127970635 missense possibly damaging 0.94
IGL01834:CK137956 APN 4 127946649 missense probably damaging 1.00
R0117:CK137956 UTSW 4 127946792 missense possibly damaging 0.63
R0456:CK137956 UTSW 4 127945307 missense probably damaging 0.99
R0492:CK137956 UTSW 4 127951300 missense probably benign 0.03
R1793:CK137956 UTSW 4 127951449 missense probably benign
R1869:CK137956 UTSW 4 127970534 missense possibly damaging 0.92
R1932:CK137956 UTSW 4 127946858 missense possibly damaging 0.89
R2011:CK137956 UTSW 4 127951036 missense probably benign 0.25
R2030:CK137956 UTSW 4 127951387 missense probably benign 0.23
R2032:CK137956 UTSW 4 127945276 missense probably benign 0.38
R2135:CK137956 UTSW 4 127951640 splice site probably benign
R3608:CK137956 UTSW 4 127951326 missense probably damaging 1.00
R3895:CK137956 UTSW 4 127946648 missense probably benign 0.01
R4165:CK137956 UTSW 4 127970729 missense possibly damaging 0.83
R5610:CK137956 UTSW 4 127946647 critical splice donor site probably null
R6861:CK137956 UTSW 4 127970726 missense probably damaging 0.98
R7149:CK137956 UTSW 4 127970833 start codon destroyed probably null 0.53
R8132:CK137956 UTSW 4 127951282 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGACACTCTTGACCTTGGC -3'
(R):5'- AATGGCCTAGTGGGTGATGC -3'

Sequencing Primer
(F):5'- ATGCCGGTGACTGTAGACATG -3'
(R):5'- CTGCTGGCAGAGTCGTC -3'
Posted On2015-01-11