Incidental Mutation 'R2994:Ripor2'
ID 257153
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene Name RHO family interacting cell polarization regulator 2
Synonyms 1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik
MMRRC Submission 040529-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R2994 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 24685513-24917789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24885610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 576 (D576V)
Ref Sequence ENSEMBL: ENSMUSP00000089286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
AlphaFold Q80U16
Predicted Effect possibly damaging
Transcript: ENSMUST00000038477
AA Change: D615V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: D615V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058009
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: D576V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: D576V

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110383
AA Change: D590V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: D590V

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110384
AA Change: D615V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: D615V

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134370
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,603,538 (GRCm39) S577P probably damaging Het
Agrn T C 4: 156,251,785 (GRCm39) T1826A possibly damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Btnl6 C A 17: 34,734,498 (GRCm39) R88I possibly damaging Het
Cfap52 T A 11: 67,830,617 (GRCm39) Y281F probably benign Het
CK137956 T C 4: 127,845,300 (GRCm39) T148A probably benign Het
Fpr3 C T 17: 18,191,130 (GRCm39) Q134* probably null Het
Gbp4 A T 5: 105,284,886 (GRCm39) M1K probably null Het
Gpsm1 G A 2: 26,209,843 (GRCm39) probably benign Het
Nedd4 A G 9: 72,638,185 (GRCm39) D440G probably benign Het
Nlgn1 C T 3: 25,490,162 (GRCm39) D522N probably damaging Het
Oprk1 T C 1: 5,672,955 (GRCm39) V364A probably benign Het
Or1e35 T C 11: 73,797,541 (GRCm39) Y259C probably damaging Het
Or5d18 A G 2: 87,865,301 (GRCm39) Y61H probably damaging Het
Polr1e T C 4: 45,027,473 (GRCm39) probably null Het
Psmd11 T C 11: 80,351,493 (GRCm39) Y239H probably damaging Het
Rundc3a C T 11: 102,291,489 (GRCm39) T327I probably damaging Het
Sh3rf1 A G 8: 61,825,609 (GRCm39) T535A probably benign Het
Slc13a2 T A 11: 78,295,563 (GRCm39) E101V probably damaging Het
Tg A T 15: 66,553,802 (GRCm39) T406S probably benign Het
Tjp2 T C 19: 24,090,215 (GRCm39) E609G probably damaging Het
Zfp459 G A 13: 67,556,853 (GRCm39) P77S possibly damaging Het
Zfp612 A G 8: 110,816,049 (GRCm39) K380E probably damaging Het
Zfp629 T C 7: 127,210,228 (GRCm39) E527G probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24,885,190 (GRCm39) missense probably benign 0.11
IGL02145:Ripor2 APN 13 24,901,554 (GRCm39) missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24,879,549 (GRCm39) splice site probably benign
IGL02533:Ripor2 APN 13 24,885,378 (GRCm39) nonsense probably null
IGL02798:Ripor2 APN 13 24,858,649 (GRCm39) missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24,879,681 (GRCm39) missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24,880,512 (GRCm39) missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24,907,702 (GRCm39) missense probably damaging 1.00
gentleman UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
Jack UTSW 13 24,861,824 (GRCm39) nonsense probably null
whitechapel UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R0045:Ripor2 UTSW 13 24,878,209 (GRCm39) missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24,864,615 (GRCm39) missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24,864,627 (GRCm39) missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24,878,169 (GRCm39) missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24,861,824 (GRCm39) nonsense probably null
R1374:Ripor2 UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R1564:Ripor2 UTSW 13 24,859,768 (GRCm39) missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24,885,237 (GRCm39) missense probably benign 0.10
R1889:Ripor2 UTSW 13 24,877,870 (GRCm39) missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24,897,701 (GRCm39) missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24,905,817 (GRCm39) critical splice donor site probably null
R2209:Ripor2 UTSW 13 24,885,595 (GRCm39) missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24,855,755 (GRCm39) missense probably benign 0.08
R2392:Ripor2 UTSW 13 24,890,206 (GRCm39) missense probably benign 0.00
R4008:Ripor2 UTSW 13 24,880,521 (GRCm39) missense probably benign
R4287:Ripor2 UTSW 13 24,908,992 (GRCm39) missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4365:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4366:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4868:Ripor2 UTSW 13 24,878,124 (GRCm39) missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24,858,649 (GRCm39) missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24,798,627 (GRCm39) start gained probably benign
R6157:Ripor2 UTSW 13 24,885,052 (GRCm39) missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24,894,113 (GRCm39) missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24,861,828 (GRCm39) missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24,859,803 (GRCm39) missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24,890,215 (GRCm39) missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24,855,829 (GRCm39) missense probably benign 0.00
R7041:Ripor2 UTSW 13 24,877,749 (GRCm39) missense probably benign 0.18
R7196:Ripor2 UTSW 13 24,888,808 (GRCm39) missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24,855,886 (GRCm39) missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24,885,427 (GRCm39) nonsense probably null
R7417:Ripor2 UTSW 13 24,880,533 (GRCm39) missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24,878,188 (GRCm39) missense probably benign 0.01
R7448:Ripor2 UTSW 13 24,854,054 (GRCm39) missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24,880,290 (GRCm39) missense unknown
R7499:Ripor2 UTSW 13 24,877,755 (GRCm39) missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24,897,683 (GRCm39) missense probably benign 0.01
R8157:Ripor2 UTSW 13 24,879,600 (GRCm39) missense probably benign 0.05
R8364:Ripor2 UTSW 13 24,894,176 (GRCm39) missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24,907,771 (GRCm39) missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24,849,451 (GRCm39) intron probably benign
R8751:Ripor2 UTSW 13 24,885,050 (GRCm39) missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24,901,651 (GRCm39) missense possibly damaging 0.93
R8867:Ripor2 UTSW 13 24,822,760 (GRCm39) intron probably benign
R9079:Ripor2 UTSW 13 24,915,637 (GRCm39) missense probably benign 0.35
R9187:Ripor2 UTSW 13 24,897,632 (GRCm39) missense probably benign 0.01
R9316:Ripor2 UTSW 13 24,905,719 (GRCm39) missense probably benign 0.09
R9320:Ripor2 UTSW 13 24,915,663 (GRCm39) missense probably damaging 1.00
R9355:Ripor2 UTSW 13 24,885,694 (GRCm39) missense probably benign 0.00
R9655:Ripor2 UTSW 13 24,908,983 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AATCGGATGAGGCCTCTGAG -3'
(R):5'- AGGTATACACTGGTCCTGTGAC -3'

Sequencing Primer
(F):5'- ATGAGGCCTCTGAGCTCAAG -3'
(R):5'- CTTGGTTCAGATCCTGGA -3'
Posted On 2015-01-11