Mutagenetix > Incidental Mutation

Incidental Mutation 'R0325:Kcnd2'

25716

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

038535-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R0325 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21216683 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 129 (I129V)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably damaging
Transcript: ENSMUST00000081542
AA Change: I129V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: I129V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,266	Q278K	possibly damaging	Het
4933416C03Rik	T	C	10: 116,113,569	I17M	probably damaging	Het
5330417C22Rik	A	G	3: 108,461,251	L808P	probably damaging	Het
Adcyap1	A	G	17: 93,202,832	D96G	probably benign	Het
Adgrv1	C	T	13: 81,540,015	V1749M	probably damaging	Het
Adnp2	A	T	18: 80,130,653	N180K	probably benign	Het
Ahdc1	G	T	4: 133,062,719	A424S	unknown	Het
Alpk3	G	A	7: 81,067,953	R86H	possibly damaging	Het
Atf7ip	A	C	6: 136,560,989	T49P	possibly damaging	Het
Atp7b	G	A	8: 22,028,451	L124F	probably benign	Het
Bub1	A	T	2: 127,801,394	L1010*	probably null	Het
Cd300c	C	A	11: 114,959,585	E131*	probably null	Het
Cep135	A	G	5: 76,615,743	K527E	probably damaging	Het
Cfd	G	T	10: 79,891,758	E89*	probably null	Het
Crb1	A	C	1: 139,241,166	C871W	probably damaging	Het
D6Ertd527e	A	T	6: 87,111,295	S147C	unknown	Het
Ddx60	A	T	8: 61,983,855	E946D	probably benign	Het
Dmrt1	G	A	19: 25,546,007	E241K	probably benign	Het
Dnah11	C	G	12: 118,012,339	V2782L	probably benign	Het
Dzip1	T	C	14: 118,909,557	I313M	probably damaging	Het
Egln3	T	C	12: 54,203,512	E17G	probably benign	Het
Eif3d	A	G	15: 77,968,220	V42A	probably damaging	Het
Eogt	C	A	6: 97,113,955	G408W	probably damaging	Het
Fip1l1	T	A	5: 74,595,842	N498K	probably damaging	Het
Fmn2	T	A	1: 174,609,954		probably null	Het
Fndc3b	T	C	3: 27,467,430	E532G	probably damaging	Het
Gabrb3	T	C	7: 57,765,530	L116P	probably damaging	Het
Galnt6	A	T	15: 100,693,471		probably null	Het
Glmp	G	A	3: 88,325,084	M1I	probably null	Het
Gm13101	A	T	4: 143,966,740	V56E	probably damaging	Het
Gm13124	T	C	4: 144,555,511	Y237C	probably damaging	Het
Gm5478	T	C	15: 101,644,326	D79G	probably damaging	Het
Gnb1	T	G	4: 155,551,683	D153E	probably benign	Het
Grik2	T	C	10: 49,240,725	I86V	probably damaging	Het
Hdac3	C	T	18: 37,940,952		probably null	Het
Hdgfl2	G	A	17: 56,099,181	R523H	possibly damaging	Het
Ifngr1	T	A	10: 19,597,432	N43K	probably damaging	Het
Iqgap1	A	G	7: 80,751,930	W476R	probably benign	Het
Jag1	A	G	2: 137,095,445		probably null	Het
Kars	T	C	8: 112,008,216	D46G	probably benign	Het
Lama3	A	C	18: 12,482,126	D1369A	probably damaging	Het
Lars	A	T	18: 42,250,902	V76E	possibly damaging	Het
Lgals9	T	C	11: 78,963,448	I337V	probably damaging	Het
Lrp1b	T	C	2: 40,851,711	D3068G	probably damaging	Het
Med12l	A	G	3: 59,077,059	T462A	possibly damaging	Het
Megf9	T	A	4: 70,455,941	D286V	probably damaging	Het
Meox1	T	A	11: 101,879,401	S167C	probably damaging	Het
Mier2	C	T	10: 79,542,596		probably null	Het
Mrps2	C	A	2: 28,469,779	T216K	probably damaging	Het
Mto1	A	T	9: 78,453,004	D258V	probably damaging	Het
Mug1	A	T	6: 121,849,842	H208L	probably benign	Het
Myo15b	T	A	11: 115,884,265	I751N	probably damaging	Het
Napg	C	T	18: 62,986,963	R149C	probably damaging	Het
Ndrg4	T	A	8: 95,710,935	M17K	probably damaging	Het
Nfrkb	T	G	9: 31,414,180	M973R	probably benign	Het
Nxph4	C	T	10: 127,526,911	R37H	probably damaging	Het
Oas1e	A	G	5: 120,795,395	I35T	probably damaging	Het
Oc90	C	T	15: 65,897,665		probably null	Het
Olfr1045	G	A	2: 86,198,711	L14F	possibly damaging	Het
Olfr1076	A	T	2: 86,509,205	T249S	probably benign	Het
Olfr1271	A	T	2: 90,265,536	M298K	probably null	Het
Olfr461	A	T	6: 40,544,123	N285K	possibly damaging	Het
Olfr653	A	T	7: 104,580,360	D238V	probably damaging	Het
Papola	T	A	12: 105,807,193	I157N	probably damaging	Het
Pcyox1l	G	C	18: 61,697,893	P303A	possibly damaging	Het
Pkdrej	T	C	15: 85,819,551	N728S	probably benign	Het
Pkp4	A	G	2: 59,318,529	D542G	probably damaging	Het
Pla2g5	C	T	4: 138,800,656	D100N	probably benign	Het
Poln	C	T	5: 34,149,764	R31H	probably benign	Het
Ppp3ca	G	A	3: 136,935,139	A484T	probably benign	Het
Prag1	A	G	8: 36,103,804	T514A	probably benign	Het
Prex2	G	A	1: 11,200,057		probably null	Het
Prrc2b	G	T	2: 32,199,091	W403L	probably damaging	Het
Pter	A	T	2: 13,000,937	K307M	probably damaging	Het
Ptpn5	G	A	7: 47,090,758	S99L	probably benign	Het
Ptpn5	A	C	7: 47,090,759	S99A	probably benign	Het
Rpap1	A	C	2: 119,771,840	H674Q	probably benign	Het
Rph3a	A	T	5: 120,943,064	D623E	probably benign	Het
Sdr9c7	G	T	10: 127,898,719	E25D	probably benign	Het
Sept9	T	G	11: 117,356,632	V479G	probably damaging	Het
Sgo2a	A	G	1: 58,016,697	D680G	probably benign	Het
Sgo2b	A	T	8: 63,928,376	I474N	probably benign	Het
Sgsm1	A	T	5: 113,288,835	I43N	probably damaging	Het
Shprh	G	A	10: 11,170,109	M891I	probably benign	Het
Skiv2l	A	T	17: 34,844,815	Y551N	possibly damaging	Het
Slc12a9	A	G	5: 137,322,846	M469T	probably damaging	Het
Slc4a2	A	T	5: 24,435,943	I747F	probably damaging	Het
Slc7a6	T	A	8: 106,194,517	N373K	probably damaging	Het
Slc7a6os	T	C	8: 106,201,056	D296G	probably benign	Het
Sncaip	A	G	18: 52,905,809	T120A	probably damaging	Het
Sorcs1	G	C	19: 50,313,042		probably null	Het
Spata16	A	G	3: 26,667,456	E42G	probably damaging	Het
Syne2	A	T	12: 75,962,641	M2440L	probably benign	Het
Tead2	A	G	7: 45,225,755	E232G	probably damaging	Het
Tmf1	T	G	6: 97,176,504	T203P	possibly damaging	Het
Trrap	C	A	5: 144,816,395	H1843Q	probably benign	Het
Unc79	C	A	12: 103,171,644	Q2314K	probably damaging	Het
Unc80	G	T	1: 66,510,881	G766V	probably damaging	Het
Vmn1r217	A	G	13: 23,114,594	L46P	probably damaging	Het
Vmn2r80	A	T	10: 79,148,939	I42F	possibly damaging	Het
Vwa5a	T	C	9: 38,728,665	V403A	probably damaging	Het
Zfp42	T	C	8: 43,295,951	E171G	probably damaging	Het
Zfp64	A	T	2: 168,926,040	S551T	probably benign	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAAGACACCCTGGAACGATAC -3'
(R):5'- AGACCCACATGGAACTGTTTCCAC -3'

Sequencing Primer
(F):5'- CAGACACTCTGCTGGGTAGTTC -3'
(R):5'- GGAACTGTTTCCACCACATTCG -3'

Posted On

2013-04-16