Incidental Mutation 'R2994:Btnl6'
ID 257161
Institutional Source Beutler Lab
Gene Symbol Btnl6
Ensembl Gene ENSMUSG00000092618
Gene Name butyrophilin-like 6
Synonyms Gm6519, NG13
MMRRC Submission 040529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R2994 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34507804-34517352 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34515524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Isoleucine at position 88 (R88I)
Ref Sequence ENSEMBL: ENSMUSP00000074927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075483]
AlphaFold A2CG22
Predicted Effect possibly damaging
Transcript: ENSMUST00000075483
AA Change: R88I

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074927
Gene: ENSMUSG00000092618
AA Change: R88I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.06e-5 SMART
SCOP:d1c5ch2 151 222 1e-2 SMART
Blast:IG_like 152 228 2e-23 BLAST
transmembrane domain 252 271 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
SPRY 384 509 1.23e-19 SMART
low complexity region 510 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,384,564 S577P probably damaging Het
Agrn T C 4: 156,167,328 T1826A possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap52 T A 11: 67,939,791 Y281F probably benign Het
CK137956 T C 4: 127,951,507 T148A probably benign Het
Fpr3 C T 17: 17,970,868 Q134* probably null Het
Gbp4 A T 5: 105,137,020 M1K probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Nedd4 A G 9: 72,730,903 D440G probably benign Het
Nlgn1 C T 3: 25,435,998 D522N probably damaging Het
Olfr395 T C 11: 73,906,715 Y259C probably damaging Het
Olfr73 A G 2: 88,034,957 Y61H probably damaging Het
Oprk1 T C 1: 5,602,732 V364A probably benign Het
Polr1e T C 4: 45,027,473 probably null Het
Psmd11 T C 11: 80,460,667 Y239H probably damaging Het
Ripor2 A T 13: 24,701,627 D576V probably damaging Het
Rundc3a C T 11: 102,400,663 T327I probably damaging Het
Sh3rf1 A G 8: 61,372,575 T535A probably benign Het
Slc13a2 T A 11: 78,404,737 E101V probably damaging Het
Tg A T 15: 66,681,953 T406S probably benign Het
Tjp2 T C 19: 24,112,851 E609G probably damaging Het
Zfp459 G A 13: 67,408,734 P77S possibly damaging Het
Zfp612 A G 8: 110,089,417 K380E probably damaging Het
Zfp629 T C 7: 127,611,056 E527G probably damaging Het
Other mutations in Btnl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Btnl6 APN 17 34514043 missense probably benign 0.00
IGL02501:Btnl6 APN 17 34515674 missense possibly damaging 0.82
IGL02539:Btnl6 APN 17 34508314 missense probably benign 0.00
IGL02629:Btnl6 APN 17 34514468 missense probably damaging 1.00
IGL02724:Btnl6 APN 17 34508175 nonsense probably null
IGL03366:Btnl6 APN 17 34508179 missense probably damaging 1.00
R0013:Btnl6 UTSW 17 34515531 nonsense probably null
R0025:Btnl6 UTSW 17 34514299 missense probably benign 0.02
R0144:Btnl6 UTSW 17 34514020 missense probably benign 0.29
R0255:Btnl6 UTSW 17 34508503 missense probably benign 0.01
R1474:Btnl6 UTSW 17 34513646 missense probably damaging 1.00
R1757:Btnl6 UTSW 17 34514088 missense probably benign 0.09
R1838:Btnl6 UTSW 17 34515542 missense probably damaging 0.99
R2149:Btnl6 UTSW 17 34514347 missense possibly damaging 0.47
R3441:Btnl6 UTSW 17 34508318 missense probably benign 0.06
R3809:Btnl6 UTSW 17 34508228 missense probably benign 0.00
R3936:Btnl6 UTSW 17 34517342 missense probably benign
R4462:Btnl6 UTSW 17 34508057 missense probably damaging 1.00
R4604:Btnl6 UTSW 17 34508461 missense possibly damaging 0.91
R4618:Btnl6 UTSW 17 34514146 missense probably damaging 0.98
R4832:Btnl6 UTSW 17 34513992 missense possibly damaging 0.80
R5369:Btnl6 UTSW 17 34507985 nonsense probably null
R5422:Btnl6 UTSW 17 34514107 missense possibly damaging 0.93
R6046:Btnl6 UTSW 17 34508397 missense probably damaging 1.00
R6170:Btnl6 UTSW 17 34515506 missense probably damaging 0.99
R6385:Btnl6 UTSW 17 34508369 missense probably benign 0.01
R8213:Btnl6 UTSW 17 34508883 splice site probably null
R8676:Btnl6 UTSW 17 34508069 missense probably benign 0.00
R8895:Btnl6 UTSW 17 34515417 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTCAGTTCCAAGATGGC -3'
(R):5'- TGCACTGCTAGGTCCAAAGG -3'

Sequencing Primer
(F):5'- GTTCCAAGATGGCCTCTTCATAGAAC -3'
(R):5'- CCACAGAGGAGTTCCAGGTCTTTG -3'
Posted On 2015-01-11