Incidental Mutation 'R2995:Slc4a3'
ID257164
Institutional Source Beutler Lab
Gene Symbol Slc4a3
Ensembl Gene ENSMUSG00000006576
Gene Namesolute carrier family 4 (anion exchanger), member 3
SynonymsA930038D23Rik, Ae3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2995 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75546266-75562172 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75552662 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 541 (C541*)
Ref Sequence ENSEMBL: ENSMUSP00000027415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027415] [ENSMUST00000124341] [ENSMUST00000138814] [ENSMUST00000150142] [ENSMUST00000154101]
Predicted Effect probably null
Transcript: ENSMUST00000027415
AA Change: C541*
SMART Domains Protein: ENSMUSP00000027415
Gene: ENSMUSG00000006576
AA Change: C541*

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 500 7.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124341
AA Change: V533E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116747
Gene: ENSMUSG00000006576
AA Change: V533E

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 618 2.9e-106 PFAM
low complexity region 629 639 N/A INTRINSIC
Pfam:HCO3_cotransp 674 1156 3.6e-203 PFAM
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132110
SMART Domains Protein: ENSMUSP00000119942
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
SCOP:d1hynp_ 4 72 9e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132612
Predicted Effect probably benign
Transcript: ENSMUST00000138814
SMART Domains Protein: ENSMUSP00000122749
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142257
Predicted Effect probably benign
Transcript: ENSMUST00000145258
SMART Domains Protein: ENSMUSP00000119860
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:Band_3_cyto 50 193 4.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145516
Predicted Effect probably benign
Transcript: ENSMUST00000150142
SMART Domains Protein: ENSMUSP00000120078
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154101
SMART Domains Protein: ENSMUSP00000116488
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:Band_3_cyto 152 227 2e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane anion exchange protein. The encoded protein has been found in brain, heart, kidney, small intestine, and lung. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for one knock-out allele show inner retina defects including selective ERG b-wave depression, optic nerve and retinal vessel anomalies, sheathing of retinal vessels and late onset photoreceptor death. Homozygotes for another knock-out allele are more sensitive to seizure-inducing agents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Clpb T A 7: 101,779,324 H430Q probably damaging Het
Eloa G T 4: 136,010,906 H248N probably benign Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Lhfpl2 A G 13: 94,174,458 T79A probably benign Het
Prkaa2 T C 4: 105,052,007 Y80C probably damaging Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Stard5 T C 7: 83,632,743 V36A probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Slc4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Slc4a3 APN 1 75555083 missense probably damaging 1.00
IGL00979:Slc4a3 APN 1 75554247 missense probably damaging 1.00
IGL01488:Slc4a3 APN 1 75548876 missense probably benign 0.45
IGL01567:Slc4a3 APN 1 75550882 missense probably damaging 1.00
IGL03090:Slc4a3 APN 1 75555017 missense probably benign 0.00
IGL03135:Slc4a3 APN 1 75547935 unclassified probably benign
R0004:Slc4a3 UTSW 1 75557009 unclassified probably benign
R0479:Slc4a3 UTSW 1 75551828 unclassified probably benign
R0507:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R0591:Slc4a3 UTSW 1 75549021 missense probably damaging 1.00
R0742:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R1577:Slc4a3 UTSW 1 75550891 missense probably damaging 1.00
R1794:Slc4a3 UTSW 1 75557308 missense probably damaging 0.99
R1804:Slc4a3 UTSW 1 75551717 missense probably damaging 1.00
R1911:Slc4a3 UTSW 1 75553723 missense probably damaging 1.00
R1974:Slc4a3 UTSW 1 75552191 nonsense probably null
R2696:Slc4a3 UTSW 1 75555475 missense possibly damaging 0.46
R3962:Slc4a3 UTSW 1 75556754 missense probably damaging 0.99
R4025:Slc4a3 UTSW 1 75549041 missense probably damaging 1.00
R4824:Slc4a3 UTSW 1 75550623 missense possibly damaging 0.54
R4858:Slc4a3 UTSW 1 75555085 missense probably damaging 1.00
R5075:Slc4a3 UTSW 1 75557368 missense probably damaging 1.00
R5450:Slc4a3 UTSW 1 75552656 missense probably damaging 1.00
R5636:Slc4a3 UTSW 1 75554216 missense possibly damaging 0.82
R5728:Slc4a3 UTSW 1 75549840 missense probably benign 0.05
R5921:Slc4a3 UTSW 1 75557444 critical splice donor site probably null
R5969:Slc4a3 UTSW 1 75549979 missense probably damaging 0.98
R6272:Slc4a3 UTSW 1 75554697 critical splice donor site probably null
R6749:Slc4a3 UTSW 1 75554538 nonsense probably null
R6788:Slc4a3 UTSW 1 75551315 missense probably damaging 1.00
R7308:Slc4a3 UTSW 1 75557362 missense probably benign 0.00
R7487:Slc4a3 UTSW 1 75553377 missense probably benign 0.05
R7673:Slc4a3 UTSW 1 75557351 missense probably damaging 1.00
R8004:Slc4a3 UTSW 1 75549067 critical splice donor site probably null
R8084:Slc4a3 UTSW 1 75555945 missense probably benign 0.25
R8221:Slc4a3 UTSW 1 75552166 missense probably benign 0.02
Z1176:Slc4a3 UTSW 1 75554235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAACAGGGTACTTGAGATCTG -3'
(R):5'- TTGCCAACTCCACTCCAGAG -3'

Sequencing Primer
(F):5'- GAGGTTTCTTTCGCAGTATCCAACG -3'
(R):5'- CTCCAGAGACAGACAGCTAGG -3'
Posted On2015-01-11