Incidental Mutation 'R2995:Prkaa2'
ID257167
Institutional Source Beutler Lab
Gene Symbol Prkaa2
Ensembl Gene ENSMUSG00000028518
Gene Nameprotein kinase, AMP-activated, alpha 2 catalytic subunit
Synonyms2310008I11Rik, AMPKalpha2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2995 (G1)
Quality Score143
Status Not validated
Chromosome4
Chromosomal Location105029874-105109890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105052007 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 80 (Y80C)
Ref Sequence ENSEMBL: ENSMUSP00000030243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030243]
Predicted Effect probably damaging
Transcript: ENSMUST00000030243
AA Change: Y80C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030243
Gene: ENSMUSG00000028518
AA Change: Y80C

DomainStartEndE-ValueType
S_TKc 16 268 1.47e-103 SMART
Pfam:AdenylateSensor 401 501 6.4e-18 PFAM
low complexity region 511 527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. Studies of the mouse counterpart suggest that this catalytic subunit may control whole-body insulin sensitivity and is necessary for maintaining myocardial energy homeostasis during ischemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are hyperglycemic, hypoinsulinemic, and show glucose intolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Clpb T A 7: 101,779,324 H430Q probably damaging Het
Eloa G T 4: 136,010,906 H248N probably benign Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Lhfpl2 A G 13: 94,174,458 T79A probably benign Het
Slc4a3 T A 1: 75,552,662 C541* probably null Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Stard5 T C 7: 83,632,743 V36A probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Prkaa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Prkaa2 APN 4 105075462 missense probably damaging 1.00
IGL01350:Prkaa2 APN 4 105051912 splice site probably null
IGL01474:Prkaa2 APN 4 105049332 critical splice donor site probably null
IGL02149:Prkaa2 APN 4 105040088 missense probably benign 0.01
IGL02187:Prkaa2 APN 4 105047166 missense probably benign 0.10
IGL03185:Prkaa2 APN 4 105039721 critical splice donor site probably null
R0004:Prkaa2 UTSW 4 105047091 missense probably null 1.00
R1536:Prkaa2 UTSW 4 105075450 missense probably damaging 1.00
R1588:Prkaa2 UTSW 4 105051223 missense probably damaging 0.96
R1596:Prkaa2 UTSW 4 105036329 missense probably damaging 1.00
R1920:Prkaa2 UTSW 4 105036753 nonsense probably null
R2356:Prkaa2 UTSW 4 105039721 critical splice donor site probably null
R4037:Prkaa2 UTSW 4 105051247 missense probably damaging 1.00
R4038:Prkaa2 UTSW 4 105051247 missense probably damaging 1.00
R4039:Prkaa2 UTSW 4 105051247 missense probably damaging 1.00
R4257:Prkaa2 UTSW 4 105039956 missense probably benign 0.00
R4810:Prkaa2 UTSW 4 105039814 missense probably damaging 1.00
R5387:Prkaa2 UTSW 4 105040177 missense probably damaging 1.00
R5813:Prkaa2 UTSW 4 105036094 makesense probably null
R6812:Prkaa2 UTSW 4 105047152 missense probably benign
R7417:Prkaa2 UTSW 4 105075543 missense probably benign 0.05
R8156:Prkaa2 UTSW 4 105051975 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGCACTGGAAATATGTTTGTGG -3'
(R):5'- ATCTGAAGGGGAGTCTATAAGCC -3'

Sequencing Primer
(F):5'- AAATATGTTTGTGGTTAGTTCCTTCC -3'
(R):5'- GTTATTTGTAGGCACACCAT -3'
Posted On2015-01-11