Incidental Mutation 'R2995:Eloa'
ID257168
Institutional Source Beutler Lab
Gene Symbol Eloa
Ensembl Gene ENSMUSG00000028668
Gene Nameelongin A
SynonymsTceb3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2995 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136003368-136021763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136010906 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 248 (H248N)
Ref Sequence ENSEMBL: ENSMUSP00000030427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030427]
Predicted Effect probably benign
Transcript: ENSMUST00000030427
AA Change: H248N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030427
Gene: ENSMUSG00000028668
AA Change: H248N

DomainStartEndE-ValueType
TFS2N 7 78 2.73e-26 SMART
low complexity region 162 174 N/A INTRINSIC
low complexity region 179 185 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:Elongin_A 565 663 7.2e-31 PFAM
low complexity region 704 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142289
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein elongin A, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele are severely growth retarded, exhibit a wide range of developmental anomalies and die between E10.5 and E12.5, most likely due to massive apoptosis while mutant MEFs show increased apoptosis and senescence-like growth defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Clpb T A 7: 101,779,324 H430Q probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Lhfpl2 A G 13: 94,174,458 T79A probably benign Het
Prkaa2 T C 4: 105,052,007 Y80C probably damaging Het
Slc4a3 T A 1: 75,552,662 C541* probably null Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Stard5 T C 7: 83,632,743 V36A probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Eloa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Eloa APN 4 136010765 missense probably benign 0.21
IGL00839:Eloa APN 4 136011359 missense probably damaging 1.00
IGL01349:Eloa APN 4 136014447 missense probably benign 0.00
IGL01475:Eloa APN 4 136010920 missense probably benign 0.11
IGL02185:Eloa APN 4 136012979 splice site probably benign
IGL03151:Eloa APN 4 136010421 nonsense probably null
R1737:Eloa UTSW 4 136010770 missense probably benign 0.43
R4414:Eloa UTSW 4 136011242 missense possibly damaging 0.49
R4414:Eloa UTSW 4 136011265 missense probably benign 0.14
R4704:Eloa UTSW 4 136011214 missense probably benign 0.00
R5357:Eloa UTSW 4 136009248 missense probably benign 0.41
R5437:Eloa UTSW 4 136012885 missense probably damaging 1.00
R6334:Eloa UTSW 4 136009822 missense probably damaging 0.96
R6897:Eloa UTSW 4 136012909 missense possibly damaging 0.80
R7124:Eloa UTSW 4 136009141 missense probably damaging 1.00
R7586:Eloa UTSW 4 136007199 missense probably damaging 0.99
R7689:Eloa UTSW 4 136009284 missense probably benign 0.00
R8155:Eloa UTSW 4 136007127 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGAGACTGCTGCCTTCTCTG -3'
(R):5'- TCTGACTATGGCCATGTTCAATCC -3'

Sequencing Primer
(F):5'- GTCCTTGTCTTTCTTAACAACACTAG -3'
(R):5'- TCAAATGTATACAGACCTCTCCAGG -3'
Posted On2015-01-11