Incidental Mutation 'R2995:Stard5'
ID257173
Institutional Source Beutler Lab
Gene Symbol Stard5
Ensembl Gene ENSMUSG00000046027
Gene NameStAR-related lipid transfer (START) domain containing 5
Synonyms2310058G22Rik, D7Ertd152e, 18B7-T7(GS)
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2995 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location83631959-83653127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83632743 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000074872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075418] [ENSMUST00000117410]
Predicted Effect probably damaging
Transcript: ENSMUST00000075418
AA Change: V36A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027
AA Change: V36A

DomainStartEndE-ValueType
START 7 210 8.57e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117410
AA Change: V36A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027
AA Change: V36A

DomainStartEndE-ValueType
Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208892
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vertebral transverse process morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Clpb T A 7: 101,779,324 H430Q probably damaging Het
Eloa G T 4: 136,010,906 H248N probably benign Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Lhfpl2 A G 13: 94,174,458 T79A probably benign Het
Prkaa2 T C 4: 105,052,007 Y80C probably damaging Het
Slc4a3 T A 1: 75,552,662 C541* probably null Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Stard5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Stard5 APN 7 83633189 missense probably damaging 1.00
IGL02100:Stard5 APN 7 83640445 missense possibly damaging 0.71
IGL03374:Stard5 APN 7 83636772 missense possibly damaging 0.83
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0631:Stard5 UTSW 7 83632757 missense probably damaging 1.00
R2170:Stard5 UTSW 7 83633158 missense probably benign 0.01
R4616:Stard5 UTSW 7 83633281 intron probably benign
R5372:Stard5 UTSW 7 83633220 missense probably damaging 1.00
R5628:Stard5 UTSW 7 83633147 missense probably benign 0.30
R7836:Stard5 UTSW 7 83636776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAAGGCGACTGGAGAGACTC -3'
(R):5'- GCTTGCTAGAAACGATTCAAAACAC -3'

Sequencing Primer
(F):5'- GGAGAGACTCCCACAGCTC -3'
(R):5'- GAAACGATTCAAAACACAAGCTAATG -3'
Posted On2015-01-11