Incidental Mutation 'R2995:Clpb'
ID257174
Institutional Source Beutler Lab
Gene Symbol Clpb
Ensembl Gene ENSMUSG00000001829
Gene NameClpB caseinolytic peptidase B
SynonymsSkd3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R2995 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101663633-101795506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101779324 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 430 (H430Q)
Ref Sequence ENSEMBL: ENSMUSP00000148062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000209579]
Predicted Effect probably damaging
Transcript: ENSMUST00000001884
AA Change: H430Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: H430Q

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 235 264 6.65e-6 SMART
low complexity region 294 306 N/A INTRINSIC
AAA 343 497 6.36e-10 SMART
ClpB_D2-small 541 630 6.83e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106998
AA Change: H460Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: H460Q

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 265 294 6.65e-6 SMART
low complexity region 324 336 N/A INTRINSIC
AAA 373 527 6.36e-10 SMART
ClpB_D2-small 571 660 6.83e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150832
Predicted Effect probably damaging
Transcript: ENSMUST00000209579
AA Change: H430Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Eloa G T 4: 136,010,906 H248N probably benign Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Lhfpl2 A G 13: 94,174,458 T79A probably benign Het
Prkaa2 T C 4: 105,052,007 Y80C probably damaging Het
Slc4a3 T A 1: 75,552,662 C541* probably null Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Stard5 T C 7: 83,632,743 V36A probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Clpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Clpb APN 7 101787745 missense probably benign
IGL00778:Clpb APN 7 101778608 nonsense probably null
IGL00780:Clpb APN 7 101778608 nonsense probably null
IGL00951:Clpb APN 7 101751260 missense probably benign 0.00
IGL01374:Clpb APN 7 101773128 missense probably damaging 1.00
IGL01542:Clpb APN 7 101787505 missense probably damaging 0.98
IGL02203:Clpb APN 7 101779337 missense probably damaging 1.00
IGL02989:Clpb APN 7 101779220 missense probably damaging 1.00
IGL03088:Clpb APN 7 101785449 nonsense probably null
Surfeit UTSW 7 101711465 missense probably damaging 1.00
PIT1430001:Clpb UTSW 7 101786719 missense possibly damaging 0.95
PIT4486001:Clpb UTSW 7 101663932 missense probably benign 0.17
R0611:Clpb UTSW 7 101787749 missense possibly damaging 0.71
R1565:Clpb UTSW 7 101785461 missense probably benign 0.00
R1760:Clpb UTSW 7 101786698 missense possibly damaging 0.92
R1879:Clpb UTSW 7 101706483 missense probably benign 0.23
R1933:Clpb UTSW 7 101779211 missense probably damaging 0.96
R1938:Clpb UTSW 7 101763656 missense probably damaging 1.00
R2922:Clpb UTSW 7 101722828 missense probably benign 0.02
R2923:Clpb UTSW 7 101722828 missense probably benign 0.02
R4492:Clpb UTSW 7 101787722 missense probably damaging 1.00
R5384:Clpb UTSW 7 101779341 missense probably damaging 1.00
R5973:Clpb UTSW 7 101663997 missense probably benign 0.02
R6787:Clpb UTSW 7 101663659 unclassified probably benign
R7158:Clpb UTSW 7 101663832 missense probably benign 0.45
R7225:Clpb UTSW 7 101711465 missense probably damaging 1.00
R7239:Clpb UTSW 7 101711455 missense probably damaging 0.96
R7482:Clpb UTSW 7 101786719 missense possibly damaging 0.95
R7499:Clpb UTSW 7 101722728 missense possibly damaging 0.92
R7547:Clpb UTSW 7 101664296 intron probably null
R7769:Clpb UTSW 7 101722717 missense probably damaging 0.96
R8279:Clpb UTSW 7 101706488 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGGCCCCATATTGTAGGCTA -3'
(R):5'- CTTTGTCCCTGGAGGCCTT -3'

Sequencing Primer
(F):5'- CCCTGTACTGGGGCATATAAAGAC -3'
(R):5'- TCTAGAGACGGGCTTGCTAAG -3'
Posted On2015-01-11