ID | 257176 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Symbol | Lhfpl2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ensembl Gene | ENSMUSG00000045312 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | lipoma HMGIC fusion partner-like 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | vgim | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Numbers | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Essential gene? | Possibly non essential (E-score: 0.258) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stock # | R2995 (G1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Quality Score | 225 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Status | Not validated | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 94194304-94331917 bp(+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Type of Mutation | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA Base Change (assembly) | A to G at 94310966 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Zygosity | Heterozygous | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Threonine to Alanine at position 79 (T79A) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ref Sequence | ENSEMBL: ENSMUSP00000152241 (fasta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for transcript(s): [ENSMUST00000054274] [ENSMUST00000118195] [ENSMUST00000120051] [ENSMUST00000121618] [ENSMUST00000156071] [ENSMUST00000221096] [ENSMUST00000223423] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q8BGA2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000054274 AA Change: T79A PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000062239 Gene: ENSMUSG00000045312 AA Change: T79A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000118195 AA Change: T79A PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000112655 Gene: ENSMUSG00000045312 AA Change: T79A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000120051 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000121618 AA Change: T79A PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000113468 Gene: ENSMUSG00000045312 AA Change: T79A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000131595 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000156071 AA Change: T79A PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000117113 Gene: ENSMUSG00000045312 AA Change: T79A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000221096 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000223423 AA Change: T79A PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coding Region Coverage |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Validation Efficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008] PHENOTYPE: Females homozygous for a spontaneous point mutation have a completely closed vagina, soft swelling of the perineum and buildup of viscous fluid in the uteri. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele List at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in this stock |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in Lhfpl2 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Primers |
PCR Primer (F):5'- GTCATGTCATTGTCACCTGC -3' (R):5'- TCACCTGCGATTCCCTGTAG -3' Sequencing Primer (F):5'- TGGACCCTCCTGAGTATCGTG -3' (R):5'- TAGGAGCCCGCAGACGTTG -3' |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Posted On | 2015-01-11 |