Incidental Mutation 'R2995:Lhfpl2'
ID257176
Institutional Source Beutler Lab
Gene Symbol Lhfpl2
Ensembl Gene ENSMUSG00000045312
Gene Namelipoma HMGIC fusion partner-like 2
Synonymsvgim
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R2995 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location94057796-94195409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94174458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 79 (T79A)
Ref Sequence ENSEMBL: ENSMUSP00000152241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054274] [ENSMUST00000118195] [ENSMUST00000120051] [ENSMUST00000121618] [ENSMUST00000156071] [ENSMUST00000221096] [ENSMUST00000223423]
Predicted Effect probably benign
Transcript: ENSMUST00000054274
AA Change: T79A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062239
Gene: ENSMUSG00000045312
AA Change: T79A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118195
AA Change: T79A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112655
Gene: ENSMUSG00000045312
AA Change: T79A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120051
Predicted Effect probably benign
Transcript: ENSMUST00000121618
AA Change: T79A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113468
Gene: ENSMUSG00000045312
AA Change: T79A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131595
Predicted Effect probably benign
Transcript: ENSMUST00000156071
AA Change: T79A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117113
Gene: ENSMUSG00000045312
AA Change: T79A

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 139 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221096
Predicted Effect probably benign
Transcript: ENSMUST00000223423
AA Change: T79A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for a spontaneous point mutation have a completely closed vagina, soft swelling of the perineum and buildup of viscous fluid in the uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Clpb T A 7: 101,779,324 H430Q probably damaging Het
Eloa G T 4: 136,010,906 H248N probably benign Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Prkaa2 T C 4: 105,052,007 Y80C probably damaging Het
Slc4a3 T A 1: 75,552,662 C541* probably null Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Stard5 T C 7: 83,632,743 V36A probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Lhfpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Lhfpl2 APN 13 94191911 missense probably benign 0.00
IGL02576:Lhfpl2 APN 13 94174226 start codon destroyed probably null 1.00
R0278:Lhfpl2 UTSW 13 94174435 missense probably benign 0.00
R0482:Lhfpl2 UTSW 13 94174610 missense probably damaging 1.00
R1134:Lhfpl2 UTSW 13 94174252 missense probably damaging 1.00
R2130:Lhfpl2 UTSW 13 94192049 missense possibly damaging 0.91
R2302:Lhfpl2 UTSW 13 94174546 missense probably benign 0.00
R6613:Lhfpl2 UTSW 13 94174495 missense probably damaging 1.00
R6922:Lhfpl2 UTSW 13 94174521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGTCATTGTCACCTGC -3'
(R):5'- TCACCTGCGATTCCCTGTAG -3'

Sequencing Primer
(F):5'- TGGACCCTCCTGAGTATCGTG -3'
(R):5'- TAGGAGCCCGCAGACGTTG -3'
Posted On2015-01-11