Incidental Mutation 'R2995:Arsi'
ID257178
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Namearylsulfatase i
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2995 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60911780-60918561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60916651 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 202 (G202E)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
Predicted Effect probably benign
Transcript: ENSMUST00000040359
AA Change: G202E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: G202E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A G 7: 43,499,368 C43R probably damaging Het
Clpb T A 7: 101,779,324 H430Q probably damaging Het
Eloa G T 4: 136,010,906 H248N probably benign Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Lhfpl2 A G 13: 94,174,458 T79A probably benign Het
Prkaa2 T C 4: 105,052,007 Y80C probably damaging Het
Slc4a3 T A 1: 75,552,662 C541* probably null Het
Slc4a4 A T 5: 88,934,814 E22V probably damaging Het
Stard5 T C 7: 83,632,743 V36A probably damaging Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Trpc6 G T 9: 8,544,466 G12V probably benign Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1641:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2484:Arsi UTSW 18 60916651 missense probably benign 0.07
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3884:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4212:Arsi UTSW 18 60916701 missense probably damaging 1.00
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4459:Arsi UTSW 18 60916651 missense probably benign 0.07
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
R7813:Arsi UTSW 18 60916654 missense possibly damaging 0.58
R8035:Arsi UTSW 18 60916370 missense probably damaging 1.00
Z1176:Arsi UTSW 18 60916780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGATTGCAGCACTCCATTATC -3'
(R):5'- TCACCATGGCTGCGTACTTG -3'

Sequencing Primer
(F):5'- TACAGGAGGCAGGCTACTC -3'
(R):5'- TACTTGCGCCGTGCTACG -3'
Posted On2015-01-11