Incidental Mutation 'R2997:Elp4'
ID257194
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2997 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105814316 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 228 (F228L)
Ref Sequence ENSEMBL: ENSMUSP00000116575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028588] [ENSMUST00000122965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028588
AA Change: F110L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028588
Gene: ENSMUSG00000027167
AA Change: F110L

DomainStartEndE-ValueType
Pfam:PAXNEB 2 270 9.1e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122965
AA Change: F228L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167
AA Change: F228L

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152272
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 A T 3: 148,817,649 V82E probably damaging Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl6 A T 16: 59,623,876 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC027072 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 17: 71,744,711 probably benign Het
Fndc3b A C 3: 27,468,872 D519E probably benign Het
Gbp9 T A 5: 105,082,769 I430F probably benign Het
Gm4737 G A 16: 46,153,925 T363I possibly damaging Het
Lgr4 A T 2: 110,003,517 E369D probably benign Het
Lrguk T A 6: 34,073,762 V385D probably damaging Het
Mier1 T A 4: 103,131,036 D52E probably damaging Het
Mthfd1 G T 12: 76,315,036 V139F probably benign Het
Myg1 G T 15: 102,337,510 R315L probably null Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Ttn A G 2: 76,886,006 probably benign Het
Tyw5 T C 1: 57,388,641 D268G probably damaging Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R0893:Elp4 UTSW 2 105896945 splice site probably benign
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R1911:Elp4 UTSW 2 105702743 missense probably damaging 0.96
R2311:Elp4 UTSW 2 105842332 missense probably benign 0.00
R3079:Elp4 UTSW 2 105809445 missense possibly damaging 0.95
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5438:Elp4 UTSW 2 105904403 missense probably damaging 1.00
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R7671:Elp4 UTSW 2 105904481 missense probably damaging 0.99
R8376:Elp4 UTSW 2 105842308 missense probably benign 0.00
R8918:Elp4 UTSW 2 105832255 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TTTTGTGTGCATCCTGAGAATC -3'
(R):5'- GTCAGAAACTAAGTAACTGACCCTC -3'

Sequencing Primer
(F):5'- GTGCATCCTGAGAATCTAGTAAAAAC -3'
(R):5'- CATACTGACTTCATGTTTGAA -3'
Posted On2015-01-11