Incidental Mutation 'R2997:Mier1'
ID 257199
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms 4933425I22Rik, 5830411K19Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2997 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 102971587-103022951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102988233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 52 (D52E)
Ref Sequence ENSEMBL: ENSMUSP00000102471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106857] [ENSMUST00000106858] [ENSMUST00000134533]
AlphaFold Q5UAK0
Predicted Effect probably damaging
Transcript: ENSMUST00000030247
AA Change: D52E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: D52E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097945
AA Change: D80E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: D80E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106857
AA Change: D35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: D35E

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106858
AA Change: D52E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: D52E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124348
Predicted Effect probably benign
Transcript: ENSMUST00000134533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151588
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 A T 3: 148,523,285 (GRCm39) V82E probably damaging Het
Ahcyl G A 16: 45,974,288 (GRCm39) T363I possibly damaging Het
Arid5b C T 10: 67,934,292 (GRCm39) G294S probably benign Het
Arl6 A T 16: 59,444,239 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Elp4 A G 2: 105,644,661 (GRCm39) F228L possibly damaging Het
Fndc3b A C 3: 27,523,021 (GRCm39) D519E probably benign Het
Gbp9 T A 5: 105,230,635 (GRCm39) I430F probably benign Het
Lgr4 A T 2: 109,833,862 (GRCm39) E369D probably benign Het
Lrguk T A 6: 34,050,697 (GRCm39) V385D probably damaging Het
Mthfd1 G T 12: 76,361,810 (GRCm39) V139F probably benign Het
Myg1 G T 15: 102,245,945 (GRCm39) R315L probably null Het
Pcare ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 17: 72,051,706 (GRCm39) probably benign Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,355,057 (GRCm39) probably benign Het
Ttn A G 2: 76,716,350 (GRCm39) probably benign Het
Tyw5 T C 1: 57,427,800 (GRCm39) D268G probably damaging Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103,012,769 (GRCm39) missense probably damaging 0.99
IGL01599:Mier1 APN 4 103,012,738 (GRCm39) missense possibly damaging 0.58
IGL01996:Mier1 APN 4 102,984,473 (GRCm39) missense possibly damaging 0.93
IGL02228:Mier1 APN 4 102,988,259 (GRCm39) missense possibly damaging 0.85
R0194:Mier1 UTSW 4 102,996,716 (GRCm39) splice site probably null
R0505:Mier1 UTSW 4 103,012,820 (GRCm39) splice site probably benign
R0684:Mier1 UTSW 4 102,996,631 (GRCm39) missense probably damaging 0.99
R0691:Mier1 UTSW 4 102,996,699 (GRCm39) missense probably benign 0.07
R4273:Mier1 UTSW 4 103,019,628 (GRCm39) missense possibly damaging 0.93
R4728:Mier1 UTSW 4 102,997,402 (GRCm39) missense probably damaging 1.00
R4769:Mier1 UTSW 4 102,997,417 (GRCm39) missense probably benign 0.01
R4798:Mier1 UTSW 4 102,988,195 (GRCm39) missense probably damaging 1.00
R5075:Mier1 UTSW 4 102,996,670 (GRCm39) missense probably benign 0.02
R5260:Mier1 UTSW 4 103,019,907 (GRCm39) missense probably benign 0.04
R5663:Mier1 UTSW 4 103,007,739 (GRCm39) missense probably damaging 0.96
R5924:Mier1 UTSW 4 103,016,899 (GRCm39) nonsense probably null
R7253:Mier1 UTSW 4 102,996,544 (GRCm39) splice site probably null
R7304:Mier1 UTSW 4 102,996,599 (GRCm39) nonsense probably null
R7641:Mier1 UTSW 4 102,996,637 (GRCm39) missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103,019,812 (GRCm39) missense probably benign 0.09
R8000:Mier1 UTSW 4 102,988,240 (GRCm39) missense probably damaging 1.00
R8557:Mier1 UTSW 4 102,996,543 (GRCm39) splice site probably null
R9353:Mier1 UTSW 4 103,012,800 (GRCm39) missense probably damaging 0.97
R9537:Mier1 UTSW 4 103,019,758 (GRCm39) missense probably benign 0.00
R9759:Mier1 UTSW 4 103,019,725 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCCCTCTGCACAAAAGACTATTC -3'
(R):5'- CTTCATGGTCCATTTCTGATACAG -3'

Sequencing Primer
(F):5'- GCACTGAATCTGGCTTAC -3'
(R):5'- ATAAACAGCACCGAGGTC -3'
Posted On 2015-01-11