Incidental Mutation 'R2997:Lrguk'
ID257201
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Nameleucine-rich repeats and guanylate kinase domain containing
Synonyms4921528H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2997 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34029448-34134034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34073762 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 385 (V385D)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: V385D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: V385D

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228187
AA Change: V385D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 A T 3: 148,817,649 V82E probably damaging Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl6 A T 16: 59,623,876 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC027072 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 17: 71,744,711 probably benign Het
Elp4 A G 2: 105,814,316 F228L possibly damaging Het
Fndc3b A C 3: 27,468,872 D519E probably benign Het
Gbp9 T A 5: 105,082,769 I430F probably benign Het
Gm4737 G A 16: 46,153,925 T363I possibly damaging Het
Lgr4 A T 2: 110,003,517 E369D probably benign Het
Mier1 T A 4: 103,131,036 D52E probably damaging Het
Mthfd1 G T 12: 76,315,036 V139F probably benign Het
Myg1 G T 15: 102,337,510 R315L probably null Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Ttn A G 2: 76,886,006 probably benign Het
Tyw5 T C 1: 57,388,641 D268G probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTAGAGTTGACCAGAGAGACTACGTG -3'
(R):5'- TGAGAAAGCAGCTTCCACG -3'

Sequencing Primer
(F):5'- ACTACGTGCAAGGCTGGG -3'
(R):5'- AAGCAGCTTCCACGGGGAC -3'
Posted On2015-01-11