Incidental Mutation 'R2997:Gm4737'
ID257208
Institutional Source Beutler Lab
Gene Symbol Gm4737
Ensembl Gene ENSMUSG00000048087
Gene Namepredicted gene 4737
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R2997 (G1)
Quality Score213
Status Not validated
Chromosome16
Chromosomal Location46152985-46155077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46153925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 363 (T363I)
Ref Sequence ENSEMBL: ENSMUSP00000127198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059524
AA Change: T363I

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127198
Gene: ENSMUSG00000048087
AA Change: T363I

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 A T 3: 148,817,649 V82E probably damaging Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl6 A T 16: 59,623,876 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC027072 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 17: 71,744,711 probably benign Het
Elp4 A G 2: 105,814,316 F228L possibly damaging Het
Fndc3b A C 3: 27,468,872 D519E probably benign Het
Gbp9 T A 5: 105,082,769 I430F probably benign Het
Lgr4 A T 2: 110,003,517 E369D probably benign Het
Lrguk T A 6: 34,073,762 V385D probably damaging Het
Mier1 T A 4: 103,131,036 D52E probably damaging Het
Mthfd1 G T 12: 76,315,036 V139F probably benign Het
Myg1 G T 15: 102,337,510 R315L probably null Het
Tchh CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC 3: 93,447,750 probably benign Het
Ttn A G 2: 76,886,006 probably benign Het
Tyw5 T C 1: 57,388,641 D268G probably damaging Het
Other mutations in Gm4737
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Gm4737 APN 16 46154078 missense probably benign
IGL03347:Gm4737 APN 16 46154489 missense probably benign 0.01
R0326:Gm4737 UTSW 16 46153883 missense probably benign 0.03
R0552:Gm4737 UTSW 16 46154592 missense probably benign
R0610:Gm4737 UTSW 16 46153901 missense probably damaging 1.00
R1465:Gm4737 UTSW 16 46153848 missense probably benign 0.01
R1465:Gm4737 UTSW 16 46153848 missense probably benign 0.01
R1473:Gm4737 UTSW 16 46154819 missense probably damaging 1.00
R4546:Gm4737 UTSW 16 46153967 missense possibly damaging 0.81
R4818:Gm4737 UTSW 16 46154192 missense probably damaging 1.00
R6544:Gm4737 UTSW 16 46154784 missense probably benign
R7358:Gm4737 UTSW 16 46153838 missense probably damaging 1.00
R7689:Gm4737 UTSW 16 46154607 missense probably benign 0.12
Z1176:Gm4737 UTSW 16 46154229 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGTAGCGGTAGTGATCAGGC -3'
(R):5'- GGACACTTCGATGTGGAGATTG -3'

Sequencing Primer
(F):5'- CGGTAGTGATCAGGCTTGAAG -3'
(R):5'- TTGATGTGAAGTGGCTCAATGAGAAC -3'
Posted On2015-01-11