Incidental Mutation 'R2998:Klk1b26'
ID257217
Institutional Source Beutler Lab
Gene Symbol Klk1b26
Ensembl Gene ENSMUSG00000053719
Gene Namekallikrein 1-related petidase b26
SynonymsEGF-BP type B, Egfbp2, PRECE-2, Klk26, mGK-26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R2998 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44012168-44016968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44016798 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 222 (I222F)
Ref Sequence ENSEMBL: ENSMUSP00000047488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048945]
Predicted Effect probably benign
Transcript: ENSMUST00000048945
AA Change: I222F

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047488
Gene: ENSMUSG00000053719
AA Change: I222F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 2.29e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205780
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C3 T A 17: 57,210,284 T1284S probably benign Het
Fggy T C 4: 95,849,585 C140R probably benign Het
Olfr1043 T A 2: 86,162,020 I310L probably benign Het
Piwil2 A T 14: 70,411,238 C251S probably damaging Het
Pop7 T C 5: 137,501,963 D36G probably damaging Het
Rad51b T A 12: 79,302,489 L33H probably damaging Het
Rtl1 T C 12: 109,595,096 E103G probably damaging Het
Slc13a2 T C 11: 78,404,785 D85G probably damaging Het
Stat1 T A 1: 52,151,249 N548K probably benign Het
Uggt2 A T 14: 119,049,385 Y683N probably damaging Het
Other mutations in Klk1b26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Klk1b26 APN 7 44016885 missense probably benign 0.00
IGL02179:Klk1b26 APN 7 44016312 missense probably benign
IGL03190:Klk1b26 APN 7 44012727 missense possibly damaging 0.76
R0391:Klk1b26 UTSW 7 44012727 missense probably damaging 1.00
R0483:Klk1b26 UTSW 7 44016348 missense probably benign 0.15
R1499:Klk1b26 UTSW 7 44016386 missense probably benign 0.22
R1549:Klk1b26 UTSW 7 44016402 splice site probably benign
R1991:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2103:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R3414:Klk1b26 UTSW 7 44016873 missense probably benign
R4990:Klk1b26 UTSW 7 44016249 splice site probably null
R4991:Klk1b26 UTSW 7 44016249 splice site probably null
R5527:Klk1b26 UTSW 7 44012763 missense probably benign 0.00
R5796:Klk1b26 UTSW 7 44016328 missense probably damaging 1.00
R6816:Klk1b26 UTSW 7 44016868 missense probably benign 0.00
R6938:Klk1b26 UTSW 7 44016294 missense probably benign 0.00
R7197:Klk1b26 UTSW 7 44016397 critical splice donor site probably null
R7243:Klk1b26 UTSW 7 44016267 missense not run
R7243:Klk1b26 UTSW 7 44016913 missense probably damaging 1.00
R7253:Klk1b26 UTSW 7 44014789 missense possibly damaging 0.66
R7423:Klk1b26 UTSW 7 44014769 missense probably damaging 0.99
R8270:Klk1b26 UTSW 7 44016120 missense probably benign 0.08
R8342:Klk1b26 UTSW 7 44016084 missense probably damaging 0.98
Z1088:Klk1b26 UTSW 7 44015996 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTCCCTGGAAGAGATGGC -3'
(R):5'- ACTCCAGTAGTACAGAGAATGTCAG -3'

Sequencing Primer
(F):5'- TGGAAGAGATGGCCACCC -3'
(R):5'- GACCTTAAACTCATTTGCTTCATGG -3'
Posted On2015-01-11