Incidental Mutation 'R2999:Diaph3'
ID257236
Institutional Source Beutler Lab
Gene Symbol Diaph3
Ensembl Gene ENSMUSG00000022021
Gene Namediaphanous related formin 3
Synonyms4930417P13Rik, Diap3, mDia2, p134MDia2, Drf3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2999 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location86655367-87141235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86772094 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1083 (C1083Y)
Ref Sequence ENSEMBL: ENSMUSP00000129420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022599] [ENSMUST00000168889]
Predicted Effect probably damaging
Transcript: ENSMUST00000022599
AA Change: C1083Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022599
Gene: ENSMUSG00000022021
AA Change: C1083Y

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.88e-180 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168889
AA Change: C1083Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129420
Gene: ENSMUSG00000022021
AA Change: C1083Y

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.2e-181 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227666
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for disruption of this gene display embryonic mortality and abnormal cytokinesis of RBC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1a T C 8: 84,567,742 L1178P probably damaging Het
Ccdc162 T C 10: 41,580,290 M1619V probably benign Het
Dyrk3 A T 1: 131,129,446 I330N probably damaging Het
Fmn1 A G 2: 113,365,094 T380A unknown Het
Inhbe T C 10: 127,351,374 T58A possibly damaging Het
Lama2 C T 10: 26,989,421 A2914T probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Sf1 C T 19: 6,374,876 probably benign Het
Tmem121b T C 6: 120,492,982 N258S possibly damaging Het
Tmem260 T A 14: 48,484,989 L327Q possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zcchc2 A G 1: 106,030,024 M742V probably benign Het
Other mutations in Diaph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Diaph3 APN 14 87002871 missense probably benign
IGL00809:Diaph3 APN 14 87000027 missense probably damaging 0.98
IGL01419:Diaph3 APN 14 86965553 nonsense probably null
IGL01577:Diaph3 APN 14 86906031 missense probably damaging 0.99
IGL01718:Diaph3 APN 14 86656338 missense unknown
IGL01736:Diaph3 APN 14 86918846 missense probably benign 0.01
IGL01893:Diaph3 APN 14 86918852 missense possibly damaging 0.71
IGL02316:Diaph3 APN 14 86986115 missense possibly damaging 0.88
IGL02527:Diaph3 APN 14 86810359 missense possibly damaging 0.47
IGL02586:Diaph3 APN 14 86986076 nonsense probably null
IGL02749:Diaph3 APN 14 86918825 missense probably damaging 0.99
IGL02892:Diaph3 APN 14 86866630 nonsense probably null
IGL03069:Diaph3 APN 14 86772119 missense probably damaging 1.00
IGL03191:Diaph3 APN 14 87073302 missense possibly damaging 0.75
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0011:Diaph3 UTSW 14 86866408 missense probably damaging 1.00
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0285:Diaph3 UTSW 14 87115024 missense possibly damaging 0.86
R0359:Diaph3 UTSW 14 86969502 missense probably benign 0.26
R0505:Diaph3 UTSW 14 87090964 splice site probably benign
R0551:Diaph3 UTSW 14 86910100 missense probably benign 0.45
R1295:Diaph3 UTSW 14 87007399 missense probably damaging 1.00
R1539:Diaph3 UTSW 14 86656480 missense probably damaging 1.00
R1602:Diaph3 UTSW 14 87091158 splice site probably benign
R1725:Diaph3 UTSW 14 86966323 critical splice donor site probably null
R1745:Diaph3 UTSW 14 86966560 missense probably damaging 0.96
R1747:Diaph3 UTSW 14 87073337 missense probably damaging 0.98
R1772:Diaph3 UTSW 14 86965549 missense probably damaging 1.00
R1914:Diaph3 UTSW 14 86656485 missense probably damaging 0.98
R1942:Diaph3 UTSW 14 87141120 utr 5 prime probably benign
R1999:Diaph3 UTSW 14 86984866 missense possibly damaging 0.53
R2291:Diaph3 UTSW 14 86966446 missense probably damaging 1.00
R3158:Diaph3 UTSW 14 86656456 missense possibly damaging 0.84
R3612:Diaph3 UTSW 14 87037457 missense probably null 0.89
R4170:Diaph3 UTSW 14 86985707 missense probably damaging 1.00
R4594:Diaph3 UTSW 14 86986037 missense probably damaging 0.99
R4912:Diaph3 UTSW 14 87007199 missense probably damaging 1.00
R4930:Diaph3 UTSW 14 87141166 start gained probably benign
R5063:Diaph3 UTSW 14 86984870 missense probably damaging 1.00
R5093:Diaph3 UTSW 14 86984800 missense probably damaging 1.00
R5267:Diaph3 UTSW 14 86656553 missense probably benign 0.03
R5289:Diaph3 UTSW 14 86981678 missense probably damaging 1.00
R5549:Diaph3 UTSW 14 86978670 missense probably benign 0.14
R5936:Diaph3 UTSW 14 86772116 missense possibly damaging 0.53
R5966:Diaph3 UTSW 14 86984825 missense probably damaging 1.00
R6236:Diaph3 UTSW 14 87037568 nonsense probably null
R6323:Diaph3 UTSW 14 86966453 missense probably benign 0.03
R6331:Diaph3 UTSW 14 86866540 missense probably damaging 1.00
R6362:Diaph3 UTSW 14 86772130 missense probably damaging 1.00
R6398:Diaph3 UTSW 14 86866486 missense probably damaging 1.00
R6408:Diaph3 UTSW 14 86828994 missense possibly damaging 0.68
R6469:Diaph3 UTSW 14 86656538 missense possibly damaging 0.71
R6519:Diaph3 UTSW 14 86966335 missense probably damaging 1.00
R7261:Diaph3 UTSW 14 86965457 missense probably benign 0.04
R7283:Diaph3 UTSW 14 86866584 missense probably damaging 1.00
R7782:Diaph3 UTSW 14 87037504 missense probably benign 0.00
R7811:Diaph3 UTSW 14 86981624 missense probably damaging 1.00
R8012:Diaph3 UTSW 14 87037522 missense probably benign
R8024:Diaph3 UTSW 14 86656399 missense probably damaging 1.00
R8065:Diaph3 UTSW 14 87037495 missense probably damaging 1.00
Z1176:Diaph3 UTSW 14 86656432 missense probably benign 0.09
Z1177:Diaph3 UTSW 14 87002814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAAAACAGAGCCCGTCATC -3'
(R):5'- GGTTAGCGTCCCACAGTTAAATG -3'

Sequencing Primer
(F):5'- AGAGCCCGTCATCTCAGAG -3'
(R):5'- AAGCATCACTGTTCCGAGTG -3'
Posted On2015-01-11