Incidental Mutation 'R3000:Ttc21a'
ID257257
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Nametetratricopeptide repeat domain 21A
SynonymsThm2, 4921538N17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R3000 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119937606-119967793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119952254 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 498 (Y498H)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
Predicted Effect probably benign
Transcript: ENSMUST00000035100
AA Change: Y498H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: Y498H

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A G 8: 23,119,431 K1364E probably damaging Het
Ankrd27 T A 7: 35,608,330 N331K probably damaging Het
Bco2 C A 9: 50,538,929 D324Y probably damaging Het
Cpne1 A G 2: 156,073,422 *211R probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Khdrbs1 A T 4: 129,725,663 H228Q probably damaging Het
Lrfn1 G A 7: 28,467,407 G742E probably damaging Het
Lrrc45 T A 11: 120,718,447 D377E probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mcoln3 T A 3: 146,133,907 I338N possibly damaging Het
Mep1b G A 18: 21,093,304 G408S probably damaging Het
Pdlim5 C A 3: 142,312,131 Q125H probably damaging Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Pkd1 G A 17: 24,594,486 R4000H probably damaging Het
Ripor3 A T 2: 167,991,180 Y357N probably damaging Het
Smchd1 A T 17: 71,363,038 D1679E probably benign Het
Stac3 C T 10: 127,508,147 R305C probably benign Het
Tex10 A T 4: 48,459,393 probably null Het
Txnrd2 T C 16: 18,454,513 F239S probably damaging Het
Vac14 T A 8: 110,634,317 L173Q probably damaging Het
Zfhx4 T A 3: 5,403,654 N2982K probably damaging Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119965819 missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119958116 missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119956923 missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119950835 nonsense probably null
IGL02252:Ttc21a APN 9 119956928 missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119958281 missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119942576 missense probably benign 0.01
IGL03155:Ttc21a APN 9 119943976 critical splice donor site probably null
IGL03323:Ttc21a APN 9 119940536 intron probably benign
R0054:Ttc21a UTSW 9 119943940 missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119954562 missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119939154 intron probably benign
R0541:Ttc21a UTSW 9 119956826 intron probably benign
R0545:Ttc21a UTSW 9 119958799 missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119961842 missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119954652 missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119954261 missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119942641 missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119956947 missense probably benign 0.00
R1631:Ttc21a UTSW 9 119954162 splice site probably null
R1905:Ttc21a UTSW 9 119966757 missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119964295 missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119940461 missense probably benign 0.01
R2265:Ttc21a UTSW 9 119959008 missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119966123 missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119941265 missense probably damaging 0.98
R3792:Ttc21a UTSW 9 119954165 missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119950816 intron probably benign
R4232:Ttc21a UTSW 9 119942618 missense probably benign 0.00
R4492:Ttc21a UTSW 9 119941280 missense probably benign 0.00
R4498:Ttc21a UTSW 9 119958819 missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119961762 missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119959037 missense probably benign
R4960:Ttc21a UTSW 9 119945001 missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119944961 missense probably benign 0.00
R5015:Ttc21a UTSW 9 119966129 missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119942665 missense probably benign 0.01
R5117:Ttc21a UTSW 9 119966565 missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119952212 missense probably benign 0.04
R5452:Ttc21a UTSW 9 119950971 missense probably benign 0.00
R5733:Ttc21a UTSW 9 119941261 missense probably benign
R5734:Ttc21a UTSW 9 119966666 missense probably benign
R5869:Ttc21a UTSW 9 119958792 missense probably benign 0.03
R6214:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119943962 missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119941202 missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119942635 missense probably benign 0.24
R7009:Ttc21a UTSW 9 119958073 nonsense probably null
R7060:Ttc21a UTSW 9 119966676 missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119945541 missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119959051 missense probably benign 0.01
R7438:Ttc21a UTSW 9 119945539 missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119958069 missense probably benign 0.12
R7703:Ttc21a UTSW 9 119959029 missense probably benign 0.14
R8076:Ttc21a UTSW 9 119966326 missense probably benign 0.01
R8217:Ttc21a UTSW 9 119954628 missense probably benign 0.00
RF004:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119942680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCACCTGCCTGTATCCTG -3'
(R):5'- CAGCAGCGTTCTGTGATGTG -3'

Sequencing Primer
(F):5'- AAGATTGTCCATGGCTGCAC -3'
(R):5'- CAGCGTTCTGTGATGTGCATATG -3'
Posted On2015-01-11