Incidental Mutation 'R3002:Pik3ca'
ID 257269
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
Synonyms 6330412C24Rik, caPI3K, p110alpha
MMRRC Submission 040531-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3002 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 32451203-32520256 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32516946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1058 (I1058N)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
AlphaFold P42337
Predicted Effect probably damaging
Transcript: ENSMUST00000029201
AA Change: I1058N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: I1058N

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108242
AA Change: I936N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: I936N

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108243
AA Change: I1058N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: I1058N

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195230
Meta Mutation Damage Score 0.5806 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 85,973,802 (GRCm39) W40R possibly damaging Het
A2m A G 6: 121,638,406 (GRCm39) S873G possibly damaging Het
Acd C T 8: 106,426,913 (GRCm39) probably null Het
Acly T C 11: 100,395,053 (GRCm39) K469E possibly damaging Het
Adcy6 T C 15: 98,494,541 (GRCm39) T767A probably benign Het
Bnip3 T C 7: 138,496,430 (GRCm39) I93V probably benign Het
Casq2 A G 3: 102,052,517 (GRCm39) D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 (GRCm39) D182G probably benign Het
Cep112 A G 11: 108,331,329 (GRCm39) E178G probably damaging Het
Chrd T G 16: 20,556,195 (GRCm39) Y585* probably null Het
Cnksr3 T C 10: 7,102,856 (GRCm39) probably benign Het
Csmd1 A G 8: 16,246,184 (GRCm39) F1072L probably damaging Het
Dnai2 C T 11: 114,641,297 (GRCm39) P374L probably damaging Het
Eif4g1 T A 16: 20,511,134 (GRCm39) F1289I probably damaging Het
Eprs1 T C 1: 185,156,588 (GRCm39) probably null Het
Fasn T C 11: 120,700,671 (GRCm39) D2114G probably benign Het
Fbxl17 T A 17: 63,532,072 (GRCm39) E590D probably damaging Het
Flnb G T 14: 7,907,162 (GRCm38) R1245L probably benign Het
Folh1 A C 7: 86,372,519 (GRCm39) I678M probably damaging Het
Frrs1l G T 4: 56,990,139 (GRCm39) probably benign Het
Hal G A 10: 93,343,381 (GRCm39) A542T probably damaging Het
Hs3st2 T A 7: 121,099,910 (GRCm39) M252K probably damaging Het
Il27ra G T 8: 84,758,660 (GRCm39) S499* probably null Het
Klhdc1 T A 12: 69,302,983 (GRCm39) V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lnx2 A G 5: 146,955,825 (GRCm39) V657A probably benign Het
Lrig1 G A 6: 94,585,758 (GRCm39) S810L probably damaging Het
Lyst A T 13: 13,871,290 (GRCm39) M2676L probably benign Het
Mindy4 T A 6: 55,195,349 (GRCm39) S188T probably benign Het
Mrgprb3 C T 7: 48,293,232 (GRCm39) M106I probably benign Het
Ncam1 A G 9: 49,468,526 (GRCm39) I311T probably damaging Het
Ndufa8 T A 2: 35,926,571 (GRCm39) E155V possibly damaging Het
Nr4a1 A G 15: 101,168,853 (GRCm39) probably null Het
Or2a12 A G 6: 42,904,888 (GRCm39) H241R probably damaging Het
Orc3 T C 4: 34,571,790 (GRCm39) T660A probably benign Het
Otub2 T C 12: 103,370,536 (GRCm39) S273P probably damaging Het
Otulinl T C 15: 27,664,792 (GRCm39) T55A probably benign Het
Phf11c A G 14: 59,622,289 (GRCm39) L241P probably damaging Het
Pkd2l1 A G 19: 44,143,996 (GRCm39) F359S possibly damaging Het
Plxnc1 A T 10: 94,629,080 (GRCm39) F1565I probably damaging Het
Polr1a A G 6: 71,890,000 (GRCm39) N73S probably benign Het
Polr1a T A 6: 71,942,628 (GRCm39) V1156E probably benign Het
Pon2 A G 6: 5,268,976 (GRCm39) probably null Het
Ptcd1 G A 5: 145,096,386 (GRCm39) L236F probably damaging Het
Rgl2 A G 17: 34,151,579 (GRCm39) I208V probably benign Het
Rhox2e C A X: 36,712,516 (GRCm39) P69Q probably damaging Het
Rptor G A 11: 119,763,197 (GRCm39) R927Q possibly damaging Het
Sec14l5 A G 16: 4,989,746 (GRCm39) Y230C probably damaging Het
Sele G T 1: 163,881,140 (GRCm39) G447C probably damaging Het
Slc17a1 G A 13: 24,062,564 (GRCm39) probably null Het
Slc2a4 A T 11: 69,836,751 (GRCm39) Y159* probably null Het
Slitrk5 A G 14: 111,917,014 (GRCm39) K213E probably damaging Het
Tdrd1 C A 19: 56,850,182 (GRCm39) Y981* probably null Het
Tex15 T C 8: 34,064,556 (GRCm39) Y1329H probably benign Het
Tgif2 C G 2: 156,686,114 (GRCm39) S2W probably damaging Het
Thoc5 A G 11: 4,878,688 (GRCm39) M620V probably benign Het
Tmeff2 C T 1: 51,220,994 (GRCm39) A323V probably damaging Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmem68 A C 4: 3,569,588 (GRCm39) L34W probably damaging Het
Tmtc4 A T 14: 123,170,230 (GRCm39) probably null Het
Trpm2 A T 10: 77,766,368 (GRCm39) probably null Het
Tut4 G A 4: 108,370,125 (GRCm39) E714K probably damaging Het
Tyk2 C A 9: 21,020,617 (GRCm39) R938L probably benign Het
Usp33 A T 3: 152,063,579 (GRCm39) T18S probably damaging Het
V1rd19 A T 7: 23,703,310 (GRCm39) I259F probably benign Het
Vmn2r24 A C 6: 123,781,231 (GRCm39) Q479P probably benign Het
Vmn2r98 A G 17: 19,286,125 (GRCm39) M208V probably benign Het
Wfdc6a C T 2: 164,422,225 (GRCm39) V125I probably benign Het
Zkscan17 A G 11: 59,378,077 (GRCm39) C369R probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32,516,733 (GRCm39) missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32,504,175 (GRCm39) missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32,514,084 (GRCm39) missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32,494,035 (GRCm39) missense probably benign 0.27
IGL03401:Pik3ca APN 3 32,491,963 (GRCm39) splice site probably null
Interrupted UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
Lilfella UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
Peninsular UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
Severed UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R0084:Pik3ca UTSW 3 32,516,937 (GRCm39) missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32,514,094 (GRCm39) missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32,493,902 (GRCm39) missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32,515,660 (GRCm39) missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32,504,410 (GRCm39) critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32,490,701 (GRCm39) missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32,504,176 (GRCm39) missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32,510,242 (GRCm39) missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32,504,499 (GRCm39) missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32,498,016 (GRCm39) missense probably benign 0.27
R1969:Pik3ca UTSW 3 32,505,903 (GRCm39) critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32,504,206 (GRCm39) missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32,516,943 (GRCm39) nonsense probably null
R2680:Pik3ca UTSW 3 32,498,034 (GRCm39) missense probably benign 0.00
R2680:Pik3ca UTSW 3 32,490,697 (GRCm39) nonsense probably null
R3001:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32,494,084 (GRCm39) nonsense probably null
R4416:Pik3ca UTSW 3 32,515,679 (GRCm39) missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32,492,127 (GRCm39) missense probably benign 0.20
R4822:Pik3ca UTSW 3 32,492,131 (GRCm39) missense probably benign 0.04
R4856:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32,504,202 (GRCm39) missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32,515,709 (GRCm39) missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32,516,928 (GRCm39) missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32,515,712 (GRCm39) missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32,494,863 (GRCm39) critical splice donor site probably null
R6347:Pik3ca UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
R6538:Pik3ca UTSW 3 32,493,853 (GRCm39) missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32,490,428 (GRCm39) missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32,490,367 (GRCm39) missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32,497,762 (GRCm39) nonsense probably null
R8218:Pik3ca UTSW 3 32,491,996 (GRCm39) missense possibly damaging 0.74
R8478:Pik3ca UTSW 3 32,505,997 (GRCm39) missense probably benign
R9100:Pik3ca UTSW 3 32,514,168 (GRCm39) missense probably damaging 1.00
R9169:Pik3ca UTSW 3 32,503,755 (GRCm39) critical splice donor site probably null
R9255:Pik3ca UTSW 3 32,496,981 (GRCm39) critical splice donor site probably null
R9267:Pik3ca UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
R9278:Pik3ca UTSW 3 32,508,587 (GRCm39) missense probably damaging 1.00
R9501:Pik3ca UTSW 3 32,504,062 (GRCm39) missense probably damaging 1.00
R9555:Pik3ca UTSW 3 32,505,916 (GRCm39) missense probably damaging 1.00
Z1177:Pik3ca UTSW 3 32,492,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCATGCCAATCTCTTCATC -3'
(R):5'- AAACCCTGCTTGCGTGTACAG -3'

Sequencing Primer
(F):5'- GCCTTGGACAAAACTGAG -3'
(R):5'- CAGTGTTTCAATTATAGAGCACGTTG -3'
Posted On 2015-01-11