Mutagenetix > Incidental Mutation

Incidental Mutation 'R3002:Pik3ca'

257269

Institutional Source

Beutler Lab

Gene Symbol

Pik3ca

Ensembl Gene

ENSMUSG00000027665

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Synonyms

caPI3K, 6330412C24Rik, p110alpha

MMRRC Submission

040531-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32397671-32468486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32462797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1058 (I1058N)

Ref Sequence

ENSEMBL: ENSMUSP00000103878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]

AlphaFold

P42337

Predicted Effect

probably damaging
Transcript: ENSMUST00000029201
AA Change: I1058N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: I1058N

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108242
AA Change: I936N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: I936N

Domain	Start	End	E-Value	Type
PI3K_rbd	51	170	5e-47	SMART
PI3K_C2	200	303	2.39e-35	SMART
C2	211	319	3.95e-1	SMART
PI3Ka	396	582	8.35e-99	SMART
Blast:PI3Kc	611	644	1e-11	BLAST
PI3Kc	676	943	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108243
AA Change: I1058N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: I1058N

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195230

Meta Mutation Damage Score

0.5806

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	C	1: 86,046,080	W40R	possibly damaging	Het
A2m	A	G	6: 121,661,447	S873G	possibly damaging	Het
Acd	C	T	8: 105,700,281		probably null	Het
Acly	T	C	11: 100,504,227	K469E	possibly damaging	Het
Adcy6	T	C	15: 98,596,660	T767A	probably benign	Het
Bnip3	T	C	7: 138,894,701	I93V	probably benign	Het
Casq2	A	G	3: 102,145,201	D269G	probably damaging	Het
Ccdc180	A	G	4: 45,899,988	D182G	probably benign	Het
Cep112	A	G	11: 108,440,503	E178G	probably damaging	Het
Chrd	T	G	16: 20,737,445	Y585*	probably null	Het
Cnksr3	T	C	10: 7,152,856		probably benign	Het
Csmd1	A	G	8: 16,196,170	F1072L	probably damaging	Het
Dnaic2	C	T	11: 114,750,471	P374L	probably damaging	Het
Eif4g1	T	A	16: 20,692,384	F1289I	probably damaging	Het
Eprs	T	C	1: 185,424,391		probably null	Het
Fam105a	T	C	15: 27,664,706	T55A	probably benign	Het
Fasn	T	C	11: 120,809,845	D2114G	probably benign	Het
Fbxl17	T	A	17: 63,225,077	E590D	probably damaging	Het
Flnb	G	T	14: 7,907,162	R1245L	probably benign	Het
Folh1	A	C	7: 86,723,311	I678M	probably damaging	Het
Frrs1l	G	T	4: 56,990,139		probably benign	Het
Hal	G	A	10: 93,507,519	A542T	probably damaging	Het
Hs3st2	T	A	7: 121,500,687	M252K	probably damaging	Het
Il27ra	G	T	8: 84,032,031	S499*	probably null	Het
Klhdc1	T	A	12: 69,256,209	V173D	possibly damaging	Het
Knop1	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTC	7: 118,852,449		probably benign	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lnx2	A	G	5: 147,019,015	V657A	probably benign	Het
Lrig1	G	A	6: 94,608,777	S810L	probably damaging	Het
Lyst	A	T	13: 13,696,705	M2676L	probably benign	Het
Mindy4	T	A	6: 55,218,364	S188T	probably benign	Het
Mrgprb3	C	T	7: 48,643,484	M106I	probably benign	Het
Ncam1	A	G	9: 49,557,226	I311T	probably damaging	Het
Ndufa8	T	A	2: 36,036,559	E155V	possibly damaging	Het
Nr4a1	A	G	15: 101,270,972		probably null	Het
Olfr446	A	G	6: 42,927,954	H241R	probably damaging	Het
Orc3	T	C	4: 34,571,790	T660A	probably benign	Het
Otub2	T	C	12: 103,404,277	S273P	probably damaging	Het
Phf11c	A	G	14: 59,384,840	L241P	probably damaging	Het
Pkd2l1	A	G	19: 44,155,557	F359S	possibly damaging	Het
Plxnc1	A	T	10: 94,793,218	F1565I	probably damaging	Het
Polr1a	A	G	6: 71,913,016	N73S	probably benign	Het
Polr1a	T	A	6: 71,965,644	V1156E	probably benign	Het
Pon2	A	G	6: 5,268,976		probably null	Het
Ptcd1	G	A	5: 145,159,576	L236F	probably damaging	Het
Rgl2	A	G	17: 33,932,605	I208V	probably benign	Het
Rhox2e	C	A	X: 37,530,863	P69Q	probably damaging	Het
Rptor	G	A	11: 119,872,371	R927Q	possibly damaging	Het
Sec14l5	A	G	16: 5,171,882	Y230C	probably damaging	Het
Sele	G	T	1: 164,053,571	G447C	probably damaging	Het
Slc17a1	G	A	13: 23,878,581		probably null	Het
Slc2a4	A	T	11: 69,945,925	Y159*	probably null	Het
Slitrk5	A	G	14: 111,679,582	K213E	probably damaging	Het
Tdrd1	C	A	19: 56,861,750	Y981*	probably null	Het
Tex15	T	C	8: 33,574,528	Y1329H	probably benign	Het
Tgif2	C	G	2: 156,844,194	S2W	probably damaging	Het
Thoc5	A	G	11: 4,928,688	M620V	probably benign	Het
Tmeff2	C	T	1: 51,181,835	A323V	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem68	A	C	4: 3,569,588	L34W	probably damaging	Het
Tmtc4	A	T	14: 122,932,818		probably null	Het
Trpm2	A	T	10: 77,930,534		probably null	Het
Tyk2	C	A	9: 21,109,321	R938L	probably benign	Het
Usp33	A	T	3: 152,357,942	T18S	probably damaging	Het
V1rd19	A	T	7: 24,003,885	I259F	probably benign	Het
Vmn2r24	A	C	6: 123,804,272	Q479P	probably benign	Het
Vmn2r98	A	G	17: 19,065,863	M208V	probably benign	Het
Wfdc6a	C	T	2: 164,580,305	V125I	probably benign	Het
Zcchc11	G	A	4: 108,512,928	E714K	probably damaging	Het
Zkscan17	A	G	11: 59,487,251	C369R	probably damaging	Het

Other mutations in Pik3ca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Pik3ca	APN	3	32462584	missense	probably damaging	1.00
IGL01894:Pik3ca	APN	3	32450026	missense	possibly damaging	0.91
IGL03118:Pik3ca	APN	3	32459935	missense	probably damaging	1.00
IGL03184:Pik3ca	APN	3	32439886	missense	probably benign	0.27
IGL03401:Pik3ca	APN	3	32437814	splice site	probably null
Interrupted	UTSW	3	32438062	missense	probably damaging	1.00
Lilfella	UTSW	3	32454420	missense	probably damaging	1.00
Peninsular	UTSW	3	32462821	missense	probably benign	0.38
Severed	UTSW	3	32437927	missense	possibly damaging	0.65
R0084:Pik3ca	UTSW	3	32462788	missense	possibly damaging	0.78
R0116:Pik3ca	UTSW	3	32459945	missense	probably damaging	1.00
R0278:Pik3ca	UTSW	3	32439753	missense	possibly damaging	0.60
R0513:Pik3ca	UTSW	3	32461511	missense	probably damaging	1.00
R0543:Pik3ca	UTSW	3	32450261	critical splice acceptor site	probably null
R0622:Pik3ca	UTSW	3	32436552	missense	probably damaging	1.00
R0630:Pik3ca	UTSW	3	32450027	missense	possibly damaging	0.91
R1193:Pik3ca	UTSW	3	32456093	missense	probably damaging	0.99
R1292:Pik3ca	UTSW	3	32454420	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1869:Pik3ca	UTSW	3	32450350	missense	probably damaging	0.99
R1962:Pik3ca	UTSW	3	32443867	missense	probably benign	0.27
R1969:Pik3ca	UTSW	3	32451754	critical splice acceptor site	probably null
R2006:Pik3ca	UTSW	3	32450057	missense	probably damaging	1.00
R2264:Pik3ca	UTSW	3	32437927	missense	possibly damaging	0.65
R2366:Pik3ca	UTSW	3	32462794	nonsense	probably null
R2680:Pik3ca	UTSW	3	32436548	nonsense	probably null
R2680:Pik3ca	UTSW	3	32443885	missense	probably benign	0.00
R3001:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R4303:Pik3ca	UTSW	3	32439935	nonsense	probably null
R4416:Pik3ca	UTSW	3	32461530	missense	probably damaging	0.99
R4758:Pik3ca	UTSW	3	32437978	missense	probably benign	0.20
R4822:Pik3ca	UTSW	3	32437982	missense	probably benign	0.04
R4856:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R4886:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R5297:Pik3ca	UTSW	3	32450053	missense	probably damaging	1.00
R5636:Pik3ca	UTSW	3	32461560	missense	probably damaging	1.00
R5663:Pik3ca	UTSW	3	32462779	missense	probably damaging	1.00
R6249:Pik3ca	UTSW	3	32461563	missense	probably damaging	1.00
R6264:Pik3ca	UTSW	3	32440714	critical splice donor site	probably null
R6347:Pik3ca	UTSW	3	32462821	missense	probably benign	0.38
R6538:Pik3ca	UTSW	3	32439704	missense	probably damaging	1.00
R7020:Pik3ca	UTSW	3	32436279	missense	probably damaging	0.97
R7720:Pik3ca	UTSW	3	32436218	missense	probably damaging	1.00
R7864:Pik3ca	UTSW	3	32443613	nonsense	probably null
R8218:Pik3ca	UTSW	3	32437847	missense	possibly damaging	0.74
R8478:Pik3ca	UTSW	3	32451848	missense	probably benign
R9100:Pik3ca	UTSW	3	32460019	missense	probably damaging	1.00
R9169:Pik3ca	UTSW	3	32449606	critical splice donor site	probably null
R9255:Pik3ca	UTSW	3	32442832	critical splice donor site	probably null
R9267:Pik3ca	UTSW	3	32438062	missense	probably damaging	1.00
R9278:Pik3ca	UTSW	3	32454438	missense	probably damaging	1.00
R9501:Pik3ca	UTSW	3	32449913	missense	probably damaging	1.00
R9555:Pik3ca	UTSW	3	32451767	missense	probably damaging	1.00
Z1177:Pik3ca	UTSW	3	32437967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCATGCCAATCTCTTCATC -3'
(R):5'- AAACCCTGCTTGCGTGTACAG -3'

Sequencing Primer
(F):5'- GCCTTGGACAAAACTGAG -3'
(R):5'- CAGTGTTTCAATTATAGAGCACGTTG -3'

Posted On

2015-01-11