Mutagenetix > Incidental Mutation

Incidental Mutation 'R3002:Polr1a'

257277

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

040531-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71965644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1156 (V1156E)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

AlphaFold

O35134

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: V1156E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: V1156E

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181028

Predicted Effect

unknown
Transcript: ENSMUST00000205517
AA Change: V181E

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	C	1: 86,046,080	W40R	possibly damaging	Het
A2m	A	G	6: 121,661,447	S873G	possibly damaging	Het
Acd	C	T	8: 105,700,281		probably null	Het
Acly	T	C	11: 100,504,227	K469E	possibly damaging	Het
Adcy6	T	C	15: 98,596,660	T767A	probably benign	Het
Bnip3	T	C	7: 138,894,701	I93V	probably benign	Het
Casq2	A	G	3: 102,145,201	D269G	probably damaging	Het
Ccdc180	A	G	4: 45,899,988	D182G	probably benign	Het
Cep112	A	G	11: 108,440,503	E178G	probably damaging	Het
Chrd	T	G	16: 20,737,445	Y585*	probably null	Het
Cnksr3	T	C	10: 7,152,856		probably benign	Het
Csmd1	A	G	8: 16,196,170	F1072L	probably damaging	Het
Dnaic2	C	T	11: 114,750,471	P374L	probably damaging	Het
Eif4g1	T	A	16: 20,692,384	F1289I	probably damaging	Het
Eprs	T	C	1: 185,424,391		probably null	Het
Fam105a	T	C	15: 27,664,706	T55A	probably benign	Het
Fasn	T	C	11: 120,809,845	D2114G	probably benign	Het
Fbxl17	T	A	17: 63,225,077	E590D	probably damaging	Het
Flnb	G	T	14: 7,907,162	R1245L	probably benign	Het
Folh1	A	C	7: 86,723,311	I678M	probably damaging	Het
Frrs1l	G	T	4: 56,990,139		probably benign	Het
Hal	G	A	10: 93,507,519	A542T	probably damaging	Het
Hs3st2	T	A	7: 121,500,687	M252K	probably damaging	Het
Il27ra	G	T	8: 84,032,031	S499*	probably null	Het
Klhdc1	T	A	12: 69,256,209	V173D	possibly damaging	Het
Knop1	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTC	7: 118,852,449		probably benign	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lnx2	A	G	5: 147,019,015	V657A	probably benign	Het
Lrig1	G	A	6: 94,608,777	S810L	probably damaging	Het
Lyst	A	T	13: 13,696,705	M2676L	probably benign	Het
Mindy4	T	A	6: 55,218,364	S188T	probably benign	Het
Mrgprb3	C	T	7: 48,643,484	M106I	probably benign	Het
Ncam1	A	G	9: 49,557,226	I311T	probably damaging	Het
Ndufa8	T	A	2: 36,036,559	E155V	possibly damaging	Het
Nr4a1	A	G	15: 101,270,972		probably null	Het
Olfr446	A	G	6: 42,927,954	H241R	probably damaging	Het
Orc3	T	C	4: 34,571,790	T660A	probably benign	Het
Otub2	T	C	12: 103,404,277	S273P	probably damaging	Het
Phf11c	A	G	14: 59,384,840	L241P	probably damaging	Het
Pik3ca	T	A	3: 32,462,797	I1058N	probably damaging	Het
Pkd2l1	A	G	19: 44,155,557	F359S	possibly damaging	Het
Plxnc1	A	T	10: 94,793,218	F1565I	probably damaging	Het
Pon2	A	G	6: 5,268,976		probably null	Het
Ptcd1	G	A	5: 145,159,576	L236F	probably damaging	Het
Rgl2	A	G	17: 33,932,605	I208V	probably benign	Het
Rhox2e	C	A	X: 37,530,863	P69Q	probably damaging	Het
Rptor	G	A	11: 119,872,371	R927Q	possibly damaging	Het
Sec14l5	A	G	16: 5,171,882	Y230C	probably damaging	Het
Sele	G	T	1: 164,053,571	G447C	probably damaging	Het
Slc17a1	G	A	13: 23,878,581		probably null	Het
Slc2a4	A	T	11: 69,945,925	Y159*	probably null	Het
Slitrk5	A	G	14: 111,679,582	K213E	probably damaging	Het
Tdrd1	C	A	19: 56,861,750	Y981*	probably null	Het
Tex15	T	C	8: 33,574,528	Y1329H	probably benign	Het
Tgif2	C	G	2: 156,844,194	S2W	probably damaging	Het
Thoc5	A	G	11: 4,928,688	M620V	probably benign	Het
Tmeff2	C	T	1: 51,181,835	A323V	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem68	A	C	4: 3,569,588	L34W	probably damaging	Het
Tmtc4	A	T	14: 122,932,818		probably null	Het
Trpm2	A	T	10: 77,930,534		probably null	Het
Tyk2	C	A	9: 21,109,321	R938L	probably benign	Het
Usp33	A	T	3: 152,357,942	T18S	probably damaging	Het
V1rd19	A	T	7: 24,003,885	I259F	probably benign	Het
Vmn2r24	A	C	6: 123,804,272	Q479P	probably benign	Het
Vmn2r98	A	G	17: 19,065,863	M208V	probably benign	Het
Wfdc6a	C	T	2: 164,580,305	V125I	probably benign	Het
Zcchc11	G	A	4: 108,512,928	E714K	probably damaging	Het
Zkscan17	A	G	11: 59,487,251	C369R	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTAGGTCATCACGGCCAAC -3'
(R):5'- TGAAGGCAAAGCAGACCTTC -3'

Sequencing Primer
(F):5'- AACCAGGTTCCTGCTCGC -3'
(R):5'- CCTTCTGGGTCGCAGGTGAAG -3'

Posted On

2015-01-11