Incidental Mutation 'R3002:Tex15'
ID 257285
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Name testis expressed gene 15
Synonyms 2210014E14Rik
MMRRC Submission 040531-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R3002 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 34006766-34075610 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34064556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1329 (Y1329H)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000009772
AA Change: Y1329H

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: Y1329H

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124496
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 85,973,802 (GRCm39) W40R possibly damaging Het
A2m A G 6: 121,638,406 (GRCm39) S873G possibly damaging Het
Acd C T 8: 106,426,913 (GRCm39) probably null Het
Acly T C 11: 100,395,053 (GRCm39) K469E possibly damaging Het
Adcy6 T C 15: 98,494,541 (GRCm39) T767A probably benign Het
Bnip3 T C 7: 138,496,430 (GRCm39) I93V probably benign Het
Casq2 A G 3: 102,052,517 (GRCm39) D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 (GRCm39) D182G probably benign Het
Cep112 A G 11: 108,331,329 (GRCm39) E178G probably damaging Het
Chrd T G 16: 20,556,195 (GRCm39) Y585* probably null Het
Cnksr3 T C 10: 7,102,856 (GRCm39) probably benign Het
Csmd1 A G 8: 16,246,184 (GRCm39) F1072L probably damaging Het
Dnai2 C T 11: 114,641,297 (GRCm39) P374L probably damaging Het
Eif4g1 T A 16: 20,511,134 (GRCm39) F1289I probably damaging Het
Eprs1 T C 1: 185,156,588 (GRCm39) probably null Het
Fasn T C 11: 120,700,671 (GRCm39) D2114G probably benign Het
Fbxl17 T A 17: 63,532,072 (GRCm39) E590D probably damaging Het
Flnb G T 14: 7,907,162 (GRCm38) R1245L probably benign Het
Folh1 A C 7: 86,372,519 (GRCm39) I678M probably damaging Het
Frrs1l G T 4: 56,990,139 (GRCm39) probably benign Het
Hal G A 10: 93,343,381 (GRCm39) A542T probably damaging Het
Hs3st2 T A 7: 121,099,910 (GRCm39) M252K probably damaging Het
Il27ra G T 8: 84,758,660 (GRCm39) S499* probably null Het
Klhdc1 T A 12: 69,302,983 (GRCm39) V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lnx2 A G 5: 146,955,825 (GRCm39) V657A probably benign Het
Lrig1 G A 6: 94,585,758 (GRCm39) S810L probably damaging Het
Lyst A T 13: 13,871,290 (GRCm39) M2676L probably benign Het
Mindy4 T A 6: 55,195,349 (GRCm39) S188T probably benign Het
Mrgprb3 C T 7: 48,293,232 (GRCm39) M106I probably benign Het
Ncam1 A G 9: 49,468,526 (GRCm39) I311T probably damaging Het
Ndufa8 T A 2: 35,926,571 (GRCm39) E155V possibly damaging Het
Nr4a1 A G 15: 101,168,853 (GRCm39) probably null Het
Or2a12 A G 6: 42,904,888 (GRCm39) H241R probably damaging Het
Orc3 T C 4: 34,571,790 (GRCm39) T660A probably benign Het
Otub2 T C 12: 103,370,536 (GRCm39) S273P probably damaging Het
Otulinl T C 15: 27,664,792 (GRCm39) T55A probably benign Het
Phf11c A G 14: 59,622,289 (GRCm39) L241P probably damaging Het
Pik3ca T A 3: 32,516,946 (GRCm39) I1058N probably damaging Het
Pkd2l1 A G 19: 44,143,996 (GRCm39) F359S possibly damaging Het
Plxnc1 A T 10: 94,629,080 (GRCm39) F1565I probably damaging Het
Polr1a A G 6: 71,890,000 (GRCm39) N73S probably benign Het
Polr1a T A 6: 71,942,628 (GRCm39) V1156E probably benign Het
Pon2 A G 6: 5,268,976 (GRCm39) probably null Het
Ptcd1 G A 5: 145,096,386 (GRCm39) L236F probably damaging Het
Rgl2 A G 17: 34,151,579 (GRCm39) I208V probably benign Het
Rhox2e C A X: 36,712,516 (GRCm39) P69Q probably damaging Het
Rptor G A 11: 119,763,197 (GRCm39) R927Q possibly damaging Het
Sec14l5 A G 16: 4,989,746 (GRCm39) Y230C probably damaging Het
Sele G T 1: 163,881,140 (GRCm39) G447C probably damaging Het
Slc17a1 G A 13: 24,062,564 (GRCm39) probably null Het
Slc2a4 A T 11: 69,836,751 (GRCm39) Y159* probably null Het
Slitrk5 A G 14: 111,917,014 (GRCm39) K213E probably damaging Het
Tdrd1 C A 19: 56,850,182 (GRCm39) Y981* probably null Het
Tgif2 C G 2: 156,686,114 (GRCm39) S2W probably damaging Het
Thoc5 A G 11: 4,878,688 (GRCm39) M620V probably benign Het
Tmeff2 C T 1: 51,220,994 (GRCm39) A323V probably damaging Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmem68 A C 4: 3,569,588 (GRCm39) L34W probably damaging Het
Tmtc4 A T 14: 123,170,230 (GRCm39) probably null Het
Trpm2 A T 10: 77,766,368 (GRCm39) probably null Het
Tut4 G A 4: 108,370,125 (GRCm39) E714K probably damaging Het
Tyk2 C A 9: 21,020,617 (GRCm39) R938L probably benign Het
Usp33 A T 3: 152,063,579 (GRCm39) T18S probably damaging Het
V1rd19 A T 7: 23,703,310 (GRCm39) I259F probably benign Het
Vmn2r24 A C 6: 123,781,231 (GRCm39) Q479P probably benign Het
Vmn2r98 A G 17: 19,286,125 (GRCm39) M208V probably benign Het
Wfdc6a C T 2: 164,422,225 (GRCm39) V125I probably benign Het
Zkscan17 A G 11: 59,378,077 (GRCm39) C369R probably damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 34,065,339 (GRCm39) missense probably benign 0.18
IGL00705:Tex15 APN 8 34,071,620 (GRCm39) missense probably damaging 1.00
IGL00820:Tex15 APN 8 34,069,034 (GRCm39) splice site probably benign
IGL01288:Tex15 APN 8 34,061,412 (GRCm39) missense probably benign 0.02
IGL01328:Tex15 APN 8 34,061,424 (GRCm39) nonsense probably null
IGL01359:Tex15 APN 8 34,071,926 (GRCm39) missense probably damaging 0.99
IGL01603:Tex15 APN 8 34,063,575 (GRCm39) missense possibly damaging 0.93
IGL01861:Tex15 APN 8 34,060,717 (GRCm39) missense probably damaging 1.00
IGL02052:Tex15 APN 8 34,072,493 (GRCm39) missense probably benign 0.28
IGL02560:Tex15 APN 8 34,071,779 (GRCm39) missense probably benign 0.00
IGL02677:Tex15 APN 8 34,061,108 (GRCm39) missense probably benign 0.03
IGL02739:Tex15 APN 8 34,071,721 (GRCm39) missense possibly damaging 0.68
Big_gulp UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
P0005:Tex15 UTSW 8 34,060,896 (GRCm39) missense probably benign 0.00
P0037:Tex15 UTSW 8 34,071,608 (GRCm39) missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 34,061,129 (GRCm39) missense probably damaging 1.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0595:Tex15 UTSW 8 34,062,645 (GRCm39) missense probably damaging 1.00
R0646:Tex15 UTSW 8 34,072,354 (GRCm39) missense possibly damaging 0.83
R0688:Tex15 UTSW 8 34,063,528 (GRCm39) missense probably damaging 1.00
R0842:Tex15 UTSW 8 34,061,575 (GRCm39) missense possibly damaging 0.95
R0987:Tex15 UTSW 8 34,066,875 (GRCm39) missense probably damaging 1.00
R1084:Tex15 UTSW 8 34,067,032 (GRCm39) missense probably benign 0.28
R1183:Tex15 UTSW 8 34,064,893 (GRCm39) missense probably benign 0.35
R1186:Tex15 UTSW 8 34,061,661 (GRCm39) missense probably benign 0.19
R1378:Tex15 UTSW 8 34,065,244 (GRCm39) missense probably damaging 0.99
R1500:Tex15 UTSW 8 34,065,120 (GRCm39) missense probably damaging 0.96
R1508:Tex15 UTSW 8 34,066,880 (GRCm39) missense probably damaging 1.00
R1597:Tex15 UTSW 8 34,061,511 (GRCm39) missense probably damaging 0.96
R1636:Tex15 UTSW 8 34,066,415 (GRCm39) nonsense probably null
R1639:Tex15 UTSW 8 34,060,845 (GRCm39) missense possibly damaging 0.94
R1809:Tex15 UTSW 8 34,064,262 (GRCm39) missense probably benign
R1843:Tex15 UTSW 8 34,066,682 (GRCm39) missense probably benign 0.27
R2029:Tex15 UTSW 8 34,061,302 (GRCm39) missense probably damaging 0.99
R2228:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2229:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2245:Tex15 UTSW 8 34,061,524 (GRCm39) missense possibly damaging 0.77
R2246:Tex15 UTSW 8 34,072,540 (GRCm39) missense possibly damaging 0.49
R2880:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2881:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2882:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R3001:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3020:Tex15 UTSW 8 34,066,698 (GRCm39) missense probably damaging 1.00
R3084:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3085:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3701:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3702:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3752:Tex15 UTSW 8 34,061,443 (GRCm39) missense probably benign
R4162:Tex15 UTSW 8 34,071,586 (GRCm39) missense probably damaging 1.00
R4231:Tex15 UTSW 8 34,062,165 (GRCm39) missense probably damaging 0.99
R4589:Tex15 UTSW 8 34,047,401 (GRCm39) missense probably damaging 1.00
R4707:Tex15 UTSW 8 34,072,525 (GRCm39) missense probably benign 0.00
R4773:Tex15 UTSW 8 34,072,760 (GRCm39) missense probably benign 0.42
R4967:Tex15 UTSW 8 34,064,498 (GRCm39) missense probably benign 0.34
R5063:Tex15 UTSW 8 34,072,638 (GRCm39) missense possibly damaging 0.59
R5121:Tex15 UTSW 8 34,061,794 (GRCm39) missense probably damaging 1.00
R5147:Tex15 UTSW 8 34,062,340 (GRCm39) nonsense probably null
R5166:Tex15 UTSW 8 34,066,420 (GRCm39) missense probably benign 0.07
R5173:Tex15 UTSW 8 34,061,768 (GRCm39) missense possibly damaging 0.73
R5439:Tex15 UTSW 8 34,064,199 (GRCm39) missense possibly damaging 0.93
R5537:Tex15 UTSW 8 34,061,641 (GRCm39) missense probably damaging 1.00
R5580:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R5588:Tex15 UTSW 8 34,067,215 (GRCm39) missense probably damaging 1.00
R5696:Tex15 UTSW 8 34,063,220 (GRCm39) missense probably benign 0.01
R5734:Tex15 UTSW 8 34,036,364 (GRCm39) missense probably benign 0.01
R5756:Tex15 UTSW 8 34,065,861 (GRCm39) missense probably benign 0.17
R5823:Tex15 UTSW 8 34,060,962 (GRCm39) missense possibly damaging 0.67
R6126:Tex15 UTSW 8 34,063,591 (GRCm39) missense probably benign 0.19
R6129:Tex15 UTSW 8 34,064,158 (GRCm39) missense possibly damaging 0.90
R6276:Tex15 UTSW 8 34,067,217 (GRCm39) missense possibly damaging 0.93
R6374:Tex15 UTSW 8 34,065,940 (GRCm39) missense probably damaging 1.00
R6430:Tex15 UTSW 8 34,061,329 (GRCm39) missense probably benign 0.01
R6452:Tex15 UTSW 8 34,062,844 (GRCm39) missense probably damaging 1.00
R6471:Tex15 UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
R6700:Tex15 UTSW 8 34,064,917 (GRCm39) missense possibly damaging 0.93
R6918:Tex15 UTSW 8 34,063,212 (GRCm39) missense probably benign 0.27
R6958:Tex15 UTSW 8 34,060,899 (GRCm39) missense probably benign 0.01
R6970:Tex15 UTSW 8 34,047,456 (GRCm39) missense probably benign 0.03
R7059:Tex15 UTSW 8 34,064,758 (GRCm39) missense possibly damaging 0.57
R7069:Tex15 UTSW 8 34,060,748 (GRCm39) missense probably benign
R7072:Tex15 UTSW 8 34,065,459 (GRCm39) missense possibly damaging 0.85
R7212:Tex15 UTSW 8 34,063,023 (GRCm39) missense probably damaging 1.00
R7212:Tex15 UTSW 8 34,060,854 (GRCm39) nonsense probably null
R7216:Tex15 UTSW 8 34,063,014 (GRCm39) missense possibly damaging 0.93
R7219:Tex15 UTSW 8 34,036,268 (GRCm39) missense probably benign 0.40
R7313:Tex15 UTSW 8 34,064,845 (GRCm39) missense possibly damaging 0.82
R7315:Tex15 UTSW 8 34,071,544 (GRCm39) missense probably benign 0.01
R7444:Tex15 UTSW 8 34,066,590 (GRCm39) missense possibly damaging 0.92
R7455:Tex15 UTSW 8 34,067,025 (GRCm39) missense possibly damaging 0.91
R7643:Tex15 UTSW 8 34,065,148 (GRCm39) missense probably damaging 1.00
R7644:Tex15 UTSW 8 34,064,445 (GRCm39) missense probably benign 0.01
R7724:Tex15 UTSW 8 34,036,291 (GRCm39) missense possibly damaging 0.60
R7779:Tex15 UTSW 8 34,065,309 (GRCm39) missense probably damaging 1.00
R7798:Tex15 UTSW 8 34,071,875 (GRCm39) missense possibly damaging 0.69
R7816:Tex15 UTSW 8 34,071,683 (GRCm39) missense probably benign 0.14
R7820:Tex15 UTSW 8 34,065,090 (GRCm39) missense probably damaging 0.98
R8041:Tex15 UTSW 8 34,065,874 (GRCm39) missense probably damaging 1.00
R8150:Tex15 UTSW 8 34,063,534 (GRCm39) missense probably benign 0.06
R8152:Tex15 UTSW 8 34,062,921 (GRCm39) missense possibly damaging 0.82
R8237:Tex15 UTSW 8 34,067,427 (GRCm39) missense possibly damaging 0.72
R8250:Tex15 UTSW 8 34,055,233 (GRCm39) missense probably null 0.27
R8264:Tex15 UTSW 8 34,072,390 (GRCm39) missense probably benign 0.18
R8279:Tex15 UTSW 8 34,061,765 (GRCm39) missense probably damaging 0.96
R8353:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8388:Tex15 UTSW 8 34,065,237 (GRCm39) missense probably benign 0.00
R8432:Tex15 UTSW 8 34,066,572 (GRCm39) missense probably damaging 0.99
R8453:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8489:Tex15 UTSW 8 34,067,574 (GRCm39) missense probably benign 0.02
R8670:Tex15 UTSW 8 34,064,746 (GRCm39) missense probably benign 0.19
R8703:Tex15 UTSW 8 34,062,724 (GRCm39) missense probably benign 0.00
R8871:Tex15 UTSW 8 34,066,992 (GRCm39) missense possibly damaging 0.62
R8945:Tex15 UTSW 8 34,064,724 (GRCm39) missense probably benign 0.00
R9104:Tex15 UTSW 8 34,060,950 (GRCm39) missense possibly damaging 0.86
R9132:Tex15 UTSW 8 34,067,554 (GRCm39) missense possibly damaging 0.84
R9207:Tex15 UTSW 8 34,065,784 (GRCm39) missense probably damaging 1.00
R9210:Tex15 UTSW 8 34,064,319 (GRCm39) missense possibly damaging 0.91
R9330:Tex15 UTSW 8 34,065,143 (GRCm39) missense probably benign 0.01
R9354:Tex15 UTSW 8 34,063,344 (GRCm39) missense possibly damaging 0.86
R9365:Tex15 UTSW 8 34,064,564 (GRCm39) missense possibly damaging 0.56
R9440:Tex15 UTSW 8 34,072,273 (GRCm39) missense possibly damaging 0.90
R9534:Tex15 UTSW 8 34,060,999 (GRCm39) missense probably benign 0.45
R9570:Tex15 UTSW 8 34,067,309 (GRCm39) missense probably damaging 0.96
R9574:Tex15 UTSW 8 34,064,509 (GRCm39) missense probably benign 0.09
R9618:Tex15 UTSW 8 34,062,397 (GRCm39) missense probably benign 0.35
R9655:Tex15 UTSW 8 34,066,784 (GRCm39) nonsense probably null
R9786:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R9798:Tex15 UTSW 8 34,062,721 (GRCm39) missense probably damaging 0.98
RF005:Tex15 UTSW 8 34,066,705 (GRCm39) missense probably benign 0.05
X0020:Tex15 UTSW 8 34,066,607 (GRCm39) missense probably benign 0.03
X0065:Tex15 UTSW 8 34,065,545 (GRCm39) nonsense probably null
Z1088:Tex15 UTSW 8 34,061,343 (GRCm39) missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 34,064,898 (GRCm39) missense probably benign
Z1088:Tex15 UTSW 8 34,061,838 (GRCm39) missense possibly damaging 0.68
Z1176:Tex15 UTSW 8 34,064,754 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AACAAGTGGGAATATGCTTGACC -3'
(R):5'- GGTCTCCATAGGAACTGTACAC -3'

Sequencing Primer
(F):5'- TGGGAATATGCTTGACCCAAAAG -3'
(R):5'- GTCTCCATAGGAACTGTACACTTTTC -3'
Posted On 2015-01-11