Mutagenetix > Incidental Mutation

Incidental Mutation 'R3002:Trpm2'

257290

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

040531-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R3002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 77930534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401] [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably null
Transcript: ENSMUST00000105401

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105401

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153842

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	C	1: 86,046,080	W40R	possibly damaging	Het
A2m	A	G	6: 121,661,447	S873G	possibly damaging	Het
Acd	C	T	8: 105,700,281		probably null	Het
Acly	T	C	11: 100,504,227	K469E	possibly damaging	Het
Adcy6	T	C	15: 98,596,660	T767A	probably benign	Het
Bnip3	T	C	7: 138,894,701	I93V	probably benign	Het
Casq2	A	G	3: 102,145,201	D269G	probably damaging	Het
Ccdc180	A	G	4: 45,899,988	D182G	probably benign	Het
Cep112	A	G	11: 108,440,503	E178G	probably damaging	Het
Chrd	T	G	16: 20,737,445	Y585*	probably null	Het
Cnksr3	T	C	10: 7,152,856		probably benign	Het
Csmd1	A	G	8: 16,196,170	F1072L	probably damaging	Het
Dnaic2	C	T	11: 114,750,471	P374L	probably damaging	Het
Eif4g1	T	A	16: 20,692,384	F1289I	probably damaging	Het
Eprs	T	C	1: 185,424,391		probably null	Het
Fam105a	T	C	15: 27,664,706	T55A	probably benign	Het
Fasn	T	C	11: 120,809,845	D2114G	probably benign	Het
Fbxl17	T	A	17: 63,225,077	E590D	probably damaging	Het
Flnb	G	T	14: 7,907,162	R1245L	probably benign	Het
Folh1	A	C	7: 86,723,311	I678M	probably damaging	Het
Frrs1l	G	T	4: 56,990,139		probably benign	Het
Hal	G	A	10: 93,507,519	A542T	probably damaging	Het
Hs3st2	T	A	7: 121,500,687	M252K	probably damaging	Het
Il27ra	G	T	8: 84,032,031	S499*	probably null	Het
Klhdc1	T	A	12: 69,256,209	V173D	possibly damaging	Het
Knop1	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTC	7: 118,852,449		probably benign	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lnx2	A	G	5: 147,019,015	V657A	probably benign	Het
Lrig1	G	A	6: 94,608,777	S810L	probably damaging	Het
Lyst	A	T	13: 13,696,705	M2676L	probably benign	Het
Mindy4	T	A	6: 55,218,364	S188T	probably benign	Het
Mrgprb3	C	T	7: 48,643,484	M106I	probably benign	Het
Ncam1	A	G	9: 49,557,226	I311T	probably damaging	Het
Ndufa8	T	A	2: 36,036,559	E155V	possibly damaging	Het
Nr4a1	A	G	15: 101,270,972		probably null	Het
Olfr446	A	G	6: 42,927,954	H241R	probably damaging	Het
Orc3	T	C	4: 34,571,790	T660A	probably benign	Het
Otub2	T	C	12: 103,404,277	S273P	probably damaging	Het
Phf11c	A	G	14: 59,384,840	L241P	probably damaging	Het
Pik3ca	T	A	3: 32,462,797	I1058N	probably damaging	Het
Pkd2l1	A	G	19: 44,155,557	F359S	possibly damaging	Het
Plxnc1	A	T	10: 94,793,218	F1565I	probably damaging	Het
Polr1a	A	G	6: 71,913,016	N73S	probably benign	Het
Polr1a	T	A	6: 71,965,644	V1156E	probably benign	Het
Pon2	A	G	6: 5,268,976		probably null	Het
Ptcd1	G	A	5: 145,159,576	L236F	probably damaging	Het
Rgl2	A	G	17: 33,932,605	I208V	probably benign	Het
Rhox2e	C	A	X: 37,530,863	P69Q	probably damaging	Het
Rptor	G	A	11: 119,872,371	R927Q	possibly damaging	Het
Sec14l5	A	G	16: 5,171,882	Y230C	probably damaging	Het
Sele	G	T	1: 164,053,571	G447C	probably damaging	Het
Slc17a1	G	A	13: 23,878,581		probably null	Het
Slc2a4	A	T	11: 69,945,925	Y159*	probably null	Het
Slitrk5	A	G	14: 111,679,582	K213E	probably damaging	Het
Tdrd1	C	A	19: 56,861,750	Y981*	probably null	Het
Tex15	T	C	8: 33,574,528	Y1329H	probably benign	Het
Tgif2	C	G	2: 156,844,194	S2W	probably damaging	Het
Thoc5	A	G	11: 4,928,688	M620V	probably benign	Het
Tmeff2	C	T	1: 51,181,835	A323V	probably damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmem68	A	C	4: 3,569,588	L34W	probably damaging	Het
Tmtc4	A	T	14: 122,932,818		probably null	Het
Tyk2	C	A	9: 21,109,321	R938L	probably benign	Het
Usp33	A	T	3: 152,357,942	T18S	probably damaging	Het
V1rd19	A	T	7: 24,003,885	I259F	probably benign	Het
Vmn2r24	A	C	6: 123,804,272	Q479P	probably benign	Het
Vmn2r98	A	G	17: 19,065,863	M208V	probably benign	Het
Wfdc6a	C	T	2: 164,580,305	V125I	probably benign	Het
Zcchc11	G	A	4: 108,512,928	E714K	probably damaging	Het
Zkscan17	A	G	11: 59,487,251	C369R	probably damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATGACTGCAACCCAAGATGG -3'
(R):5'- AAGGGTTTTGCTTCTGTGACAC -3'

Sequencing Primer
(F):5'- TGGATAAAGAGCAGTCACACAC -3'
(R):5'- CACGGATAGAGATGTTGGCCTC -3'

Posted On

2015-01-11