Incidental Mutation 'R3002:Flnb'
ID257295
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 040531-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3002 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7907162 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1245 (R1245L)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: R1245L

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: R1245L

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.1871 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,080 W40R possibly damaging Het
A2m A G 6: 121,661,447 S873G possibly damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adcy6 T C 15: 98,596,660 T767A probably benign Het
Bnip3 T C 7: 138,894,701 I93V probably benign Het
Casq2 A G 3: 102,145,201 D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Chrd T G 16: 20,737,445 Y585* probably null Het
Cnksr3 T C 10: 7,152,856 probably benign Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Dnaic2 C T 11: 114,750,471 P374L probably damaging Het
Eif4g1 T A 16: 20,692,384 F1289I probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Fam105a T C 15: 27,664,706 T55A probably benign Het
Fasn T C 11: 120,809,845 D2114G probably benign Het
Fbxl17 T A 17: 63,225,077 E590D probably damaging Het
Folh1 A C 7: 86,723,311 I678M probably damaging Het
Frrs1l G T 4: 56,990,139 probably benign Het
Hal G A 10: 93,507,519 A542T probably damaging Het
Hs3st2 T A 7: 121,500,687 M252K probably damaging Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klhdc1 T A 12: 69,256,209 V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lnx2 A G 5: 147,019,015 V657A probably benign Het
Lrig1 G A 6: 94,608,777 S810L probably damaging Het
Lyst A T 13: 13,696,705 M2676L probably benign Het
Mindy4 T A 6: 55,218,364 S188T probably benign Het
Mrgprb3 C T 7: 48,643,484 M106I probably benign Het
Ncam1 A G 9: 49,557,226 I311T probably damaging Het
Ndufa8 T A 2: 36,036,559 E155V possibly damaging Het
Nr4a1 A G 15: 101,270,972 probably null Het
Olfr446 A G 6: 42,927,954 H241R probably damaging Het
Orc3 T C 4: 34,571,790 T660A probably benign Het
Otub2 T C 12: 103,404,277 S273P probably damaging Het
Phf11c A G 14: 59,384,840 L241P probably damaging Het
Pik3ca T A 3: 32,462,797 I1058N probably damaging Het
Pkd2l1 A G 19: 44,155,557 F359S possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Polr1a A G 6: 71,913,016 N73S probably benign Het
Polr1a T A 6: 71,965,644 V1156E probably benign Het
Pon2 A G 6: 5,268,976 probably null Het
Ptcd1 G A 5: 145,159,576 L236F probably damaging Het
Rgl2 A G 17: 33,932,605 I208V probably benign Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Sec14l5 A G 16: 5,171,882 Y230C probably damaging Het
Sele G T 1: 164,053,571 G447C probably damaging Het
Slc17a1 G A 13: 23,878,581 probably null Het
Slc2a4 A T 11: 69,945,925 Y159* probably null Het
Slitrk5 A G 14: 111,679,582 K213E probably damaging Het
Tdrd1 C A 19: 56,861,750 Y981* probably null Het
Tex15 T C 8: 33,574,528 Y1329H probably benign Het
Tgif2 C G 2: 156,844,194 S2W probably damaging Het
Thoc5 A G 11: 4,928,688 M620V probably benign Het
Tmeff2 C T 1: 51,181,835 A323V probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A C 4: 3,569,588 L34W probably damaging Het
Tmtc4 A T 14: 122,932,818 probably null Het
Trpm2 A T 10: 77,930,534 probably null Het
Tyk2 C A 9: 21,109,321 R938L probably benign Het
Usp33 A T 3: 152,357,942 T18S probably damaging Het
V1rd19 A T 7: 24,003,885 I259F probably benign Het
Vmn2r24 A C 6: 123,804,272 Q479P probably benign Het
Vmn2r98 A G 17: 19,065,863 M208V probably benign Het
Wfdc6a C T 2: 164,580,305 V125I probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Zkscan17 A G 11: 59,487,251 C369R probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACACTTTGGAGCCAGGCTTG -3'
(R):5'- ACAAATGGCTAAGCACAGCTCTG -3'

Sequencing Primer
(F):5'- AGCCAGGCTTGTTCGATTTTAC -3'
(R):5'- GCACAGCTCTGAATAAAAGAGTTAC -3'
Posted On2015-01-11