Incidental Mutation 'R3002:Rgl2'
ID 257303
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 040531-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R3002 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34151579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 208 (I208V)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: I208V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: I208V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 85,973,802 (GRCm39) W40R possibly damaging Het
A2m A G 6: 121,638,406 (GRCm39) S873G possibly damaging Het
Acd C T 8: 106,426,913 (GRCm39) probably null Het
Acly T C 11: 100,395,053 (GRCm39) K469E possibly damaging Het
Adcy6 T C 15: 98,494,541 (GRCm39) T767A probably benign Het
Bnip3 T C 7: 138,496,430 (GRCm39) I93V probably benign Het
Casq2 A G 3: 102,052,517 (GRCm39) D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 (GRCm39) D182G probably benign Het
Cep112 A G 11: 108,331,329 (GRCm39) E178G probably damaging Het
Chrd T G 16: 20,556,195 (GRCm39) Y585* probably null Het
Cnksr3 T C 10: 7,102,856 (GRCm39) probably benign Het
Csmd1 A G 8: 16,246,184 (GRCm39) F1072L probably damaging Het
Dnai2 C T 11: 114,641,297 (GRCm39) P374L probably damaging Het
Eif4g1 T A 16: 20,511,134 (GRCm39) F1289I probably damaging Het
Eprs1 T C 1: 185,156,588 (GRCm39) probably null Het
Fasn T C 11: 120,700,671 (GRCm39) D2114G probably benign Het
Fbxl17 T A 17: 63,532,072 (GRCm39) E590D probably damaging Het
Flnb G T 14: 7,907,162 (GRCm38) R1245L probably benign Het
Folh1 A C 7: 86,372,519 (GRCm39) I678M probably damaging Het
Frrs1l G T 4: 56,990,139 (GRCm39) probably benign Het
Hal G A 10: 93,343,381 (GRCm39) A542T probably damaging Het
Hs3st2 T A 7: 121,099,910 (GRCm39) M252K probably damaging Het
Il27ra G T 8: 84,758,660 (GRCm39) S499* probably null Het
Klhdc1 T A 12: 69,302,983 (GRCm39) V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lnx2 A G 5: 146,955,825 (GRCm39) V657A probably benign Het
Lrig1 G A 6: 94,585,758 (GRCm39) S810L probably damaging Het
Lyst A T 13: 13,871,290 (GRCm39) M2676L probably benign Het
Mindy4 T A 6: 55,195,349 (GRCm39) S188T probably benign Het
Mrgprb3 C T 7: 48,293,232 (GRCm39) M106I probably benign Het
Ncam1 A G 9: 49,468,526 (GRCm39) I311T probably damaging Het
Ndufa8 T A 2: 35,926,571 (GRCm39) E155V possibly damaging Het
Nr4a1 A G 15: 101,168,853 (GRCm39) probably null Het
Or2a12 A G 6: 42,904,888 (GRCm39) H241R probably damaging Het
Orc3 T C 4: 34,571,790 (GRCm39) T660A probably benign Het
Otub2 T C 12: 103,370,536 (GRCm39) S273P probably damaging Het
Otulinl T C 15: 27,664,792 (GRCm39) T55A probably benign Het
Phf11c A G 14: 59,622,289 (GRCm39) L241P probably damaging Het
Pik3ca T A 3: 32,516,946 (GRCm39) I1058N probably damaging Het
Pkd2l1 A G 19: 44,143,996 (GRCm39) F359S possibly damaging Het
Plxnc1 A T 10: 94,629,080 (GRCm39) F1565I probably damaging Het
Polr1a A G 6: 71,890,000 (GRCm39) N73S probably benign Het
Polr1a T A 6: 71,942,628 (GRCm39) V1156E probably benign Het
Pon2 A G 6: 5,268,976 (GRCm39) probably null Het
Ptcd1 G A 5: 145,096,386 (GRCm39) L236F probably damaging Het
Rhox2e C A X: 36,712,516 (GRCm39) P69Q probably damaging Het
Rptor G A 11: 119,763,197 (GRCm39) R927Q possibly damaging Het
Sec14l5 A G 16: 4,989,746 (GRCm39) Y230C probably damaging Het
Sele G T 1: 163,881,140 (GRCm39) G447C probably damaging Het
Slc17a1 G A 13: 24,062,564 (GRCm39) probably null Het
Slc2a4 A T 11: 69,836,751 (GRCm39) Y159* probably null Het
Slitrk5 A G 14: 111,917,014 (GRCm39) K213E probably damaging Het
Tdrd1 C A 19: 56,850,182 (GRCm39) Y981* probably null Het
Tex15 T C 8: 34,064,556 (GRCm39) Y1329H probably benign Het
Tgif2 C G 2: 156,686,114 (GRCm39) S2W probably damaging Het
Thoc5 A G 11: 4,878,688 (GRCm39) M620V probably benign Het
Tmeff2 C T 1: 51,220,994 (GRCm39) A323V probably damaging Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmem68 A C 4: 3,569,588 (GRCm39) L34W probably damaging Het
Tmtc4 A T 14: 123,170,230 (GRCm39) probably null Het
Trpm2 A T 10: 77,766,368 (GRCm39) probably null Het
Tut4 G A 4: 108,370,125 (GRCm39) E714K probably damaging Het
Tyk2 C A 9: 21,020,617 (GRCm39) R938L probably benign Het
Usp33 A T 3: 152,063,579 (GRCm39) T18S probably damaging Het
V1rd19 A T 7: 23,703,310 (GRCm39) I259F probably benign Het
Vmn2r24 A C 6: 123,781,231 (GRCm39) Q479P probably benign Het
Vmn2r98 A G 17: 19,286,125 (GRCm39) M208V probably benign Het
Wfdc6a C T 2: 164,422,225 (GRCm39) V125I probably benign Het
Zkscan17 A G 11: 59,378,077 (GRCm39) C369R probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCTCATCCTCCCGGTGAG -3'
(R):5'- GGGTCAAAGGTCAAGGTCTCAC -3'

Sequencing Primer
(F):5'- TGAGTGGCCCTGTCTGAAC -3'
(R):5'- GTCAAGGTCTCACCGCATCTAG -3'
Posted On 2015-01-11