Incidental Mutation 'R3001:Vmn2r98'
ID 257348
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 040530-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R3001 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19286125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 208 (M208V)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: M208V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: M208V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 85,973,802 (GRCm39) W40R possibly damaging Het
A2m A G 6: 121,638,406 (GRCm39) S873G possibly damaging Het
Acd C T 8: 106,426,913 (GRCm39) probably null Het
Acly T C 11: 100,395,053 (GRCm39) K469E possibly damaging Het
Adcy6 T C 15: 98,494,541 (GRCm39) T767A probably benign Het
Bnip3 T C 7: 138,496,430 (GRCm39) I93V probably benign Het
Casq2 A G 3: 102,052,517 (GRCm39) D269G probably damaging Het
Ccdc180 A G 4: 45,899,988 (GRCm39) D182G probably benign Het
Cep112 A G 11: 108,331,329 (GRCm39) E178G probably damaging Het
Chrd T G 16: 20,556,195 (GRCm39) Y585* probably null Het
Csmd1 A G 8: 16,246,184 (GRCm39) F1072L probably damaging Het
Dnai2 C T 11: 114,641,297 (GRCm39) P374L probably damaging Het
Eif4g1 T A 16: 20,511,134 (GRCm39) F1289I probably damaging Het
Eprs1 T C 1: 185,156,588 (GRCm39) probably null Het
Fasn T C 11: 120,700,671 (GRCm39) D2114G probably benign Het
Fbxl17 T A 17: 63,532,072 (GRCm39) E590D probably damaging Het
Flnb G T 14: 7,907,162 (GRCm38) R1245L probably benign Het
Folh1 A C 7: 86,372,519 (GRCm39) I678M probably damaging Het
Hal G A 10: 93,343,381 (GRCm39) A542T probably damaging Het
Hs3st2 T A 7: 121,099,910 (GRCm39) M252K probably damaging Het
Il27ra G T 8: 84,758,660 (GRCm39) S499* probably null Het
Klhdc1 T A 12: 69,302,983 (GRCm39) V173D possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Krt71 C T 15: 101,648,906 (GRCm39) probably benign Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lnx2 A G 5: 146,955,825 (GRCm39) V657A probably benign Het
Lrig1 G A 6: 94,585,758 (GRCm39) S810L probably damaging Het
Lyst A T 13: 13,871,290 (GRCm39) M2676L probably benign Het
Mindy4 T A 6: 55,195,349 (GRCm39) S188T probably benign Het
Mrgprb3 C T 7: 48,293,232 (GRCm39) M106I probably benign Het
Ncam1 A G 9: 49,468,526 (GRCm39) I311T probably damaging Het
Ndufa8 T A 2: 35,926,571 (GRCm39) E155V possibly damaging Het
Nr4a1 A G 15: 101,168,853 (GRCm39) probably null Het
Or2a12 A G 6: 42,904,888 (GRCm39) H241R probably damaging Het
Orc3 T C 4: 34,571,790 (GRCm39) T660A probably benign Het
Otub2 T C 12: 103,370,536 (GRCm39) S273P probably damaging Het
Otulinl T C 15: 27,664,792 (GRCm39) T55A probably benign Het
Phf11c A G 14: 59,622,289 (GRCm39) L241P probably damaging Het
Pik3ca T A 3: 32,516,946 (GRCm39) I1058N probably damaging Het
Pkd2l1 A G 19: 44,143,996 (GRCm39) F359S possibly damaging Het
Plxnc1 A T 10: 94,629,080 (GRCm39) F1565I probably damaging Het
Polr1a T A 6: 71,942,628 (GRCm39) V1156E probably benign Het
Polr1a A G 6: 71,890,000 (GRCm39) N73S probably benign Het
Pon2 A G 6: 5,268,976 (GRCm39) probably null Het
Ptcd1 G A 5: 145,096,386 (GRCm39) L236F probably damaging Het
Rgl2 A G 17: 34,151,579 (GRCm39) I208V probably benign Het
Rptor G A 11: 119,763,197 (GRCm39) R927Q possibly damaging Het
Sacm1l T C 9: 123,414,149 (GRCm39) probably benign Het
Sec14l5 A G 16: 4,989,746 (GRCm39) Y230C probably damaging Het
Sele G T 1: 163,881,140 (GRCm39) G447C probably damaging Het
Slc17a1 G A 13: 24,062,564 (GRCm39) probably null Het
Slc2a4 A T 11: 69,836,751 (GRCm39) Y159* probably null Het
Slitrk5 A G 14: 111,917,014 (GRCm39) K213E probably damaging Het
Tdrd1 C A 19: 56,850,182 (GRCm39) Y981* probably null Het
Tex15 T C 8: 34,064,556 (GRCm39) Y1329H probably benign Het
Tgif2 C G 2: 156,686,114 (GRCm39) S2W probably damaging Het
Thoc5 A G 11: 4,878,688 (GRCm39) M620V probably benign Het
Tmeff2 C T 1: 51,220,994 (GRCm39) A323V probably damaging Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmem68 A C 4: 3,569,588 (GRCm39) L34W probably damaging Het
Tmtc4 A T 14: 123,170,230 (GRCm39) probably null Het
Trpm2 A T 10: 77,766,368 (GRCm39) probably null Het
Tut4 G A 4: 108,370,125 (GRCm39) E714K probably damaging Het
Tyk2 C A 9: 21,020,617 (GRCm39) R938L probably benign Het
Usp33 A T 3: 152,063,579 (GRCm39) T18S probably damaging Het
V1rd19 A T 7: 23,703,310 (GRCm39) I259F probably benign Het
Vmn2r24 A C 6: 123,781,231 (GRCm39) Q479P probably benign Het
Wfdc6a C T 2: 164,422,225 (GRCm39) V125I probably benign Het
Xpo7 A G 14: 70,930,085 (GRCm39) probably benign Het
Zkscan17 A G 11: 59,378,077 (GRCm39) C369R probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTAAGTCCTTGAAACTTGCAG -3'
(R):5'- CCATATTTTCCCAGAATTTGGCAAC -3'

Sequencing Primer
(F):5'- GTCCTTGAAACTTGCAGGCCTAAC -3'
(R):5'- TGGCAACATATGAAGTCCATGTG -3'
Posted On 2015-01-11