Incidental Mutation 'R3003:Lct'
ID 257353
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Name lactase
Synonyms LPH, LOC226413, Lphl
MMRRC Submission 040532-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3003 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 128212493-128256055 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128231963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 629 (M629V)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
AlphaFold F8VPT3
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: M629V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: M629V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Meta Mutation Damage Score 0.3962 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,254,393 (GRCm39) V568A probably damaging Het
Acd C T 8: 106,426,913 (GRCm39) probably null Het
Acly T C 11: 100,395,053 (GRCm39) K469E possibly damaging Het
Adh6b G T 3: 138,063,532 (GRCm39) L248F possibly damaging Het
Atg9b G T 5: 24,596,217 (GRCm39) D192E probably damaging Het
Ccdc180 A G 4: 45,899,988 (GRCm39) D182G probably benign Het
Cep112 A G 11: 108,331,329 (GRCm39) E178G probably damaging Het
Clptm1l C T 13: 73,765,875 (GRCm39) T471I possibly damaging Het
Csmd1 A G 8: 16,246,184 (GRCm39) F1072L probably damaging Het
Eprs1 T C 1: 185,156,588 (GRCm39) probably null Het
Il27ra G T 8: 84,758,660 (GRCm39) S499* probably null Het
Klk1b11 T C 7: 43,426,419 (GRCm39) I51T probably damaging Het
Mprip A G 11: 59,618,381 (GRCm39) T91A possibly damaging Het
Pfpl T C 19: 12,407,690 (GRCm39) I647T possibly damaging Het
Plxnc1 A T 10: 94,629,080 (GRCm39) F1565I probably damaging Het
Prr5 G T 15: 84,656,031 (GRCm39) C344F probably damaging Het
Rnf17 T C 14: 56,738,004 (GRCm39) W1262R probably damaging Het
Rptor G A 11: 119,763,197 (GRCm39) R927Q possibly damaging Het
Slitrk5 A G 14: 111,917,014 (GRCm39) K213E probably damaging Het
Smarcd1 C A 15: 99,610,065 (GRCm39) P432Q probably damaging Het
Stat4 A G 1: 52,142,145 (GRCm39) D664G probably damaging Het
Suz12 T A 11: 79,910,587 (GRCm39) W313R probably damaging Het
Sycp2 T C 2: 177,999,916 (GRCm39) Y1020C probably benign Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmem81 A G 1: 132,435,752 (GRCm39) N186S probably benign Het
Tut4 G A 4: 108,370,125 (GRCm39) E714K probably damaging Het
Vmn2r98 A G 17: 19,286,125 (GRCm39) M208V probably benign Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128,215,293 (GRCm39) missense probably benign 0.09
IGL00970:Lct APN 1 128,231,805 (GRCm39) missense probably damaging 1.00
IGL01022:Lct APN 1 128,228,596 (GRCm39) missense probably benign
IGL01878:Lct APN 1 128,222,003 (GRCm39) missense probably damaging 1.00
IGL01892:Lct APN 1 128,235,342 (GRCm39) missense probably damaging 1.00
IGL02307:Lct APN 1 128,214,327 (GRCm39) missense possibly damaging 0.70
IGL02434:Lct APN 1 128,231,527 (GRCm39) missense probably damaging 0.97
IGL02559:Lct APN 1 128,222,003 (GRCm39) missense probably damaging 1.00
IGL02623:Lct APN 1 128,235,988 (GRCm39) missense probably benign 0.01
IGL02818:Lct APN 1 128,227,905 (GRCm39) missense probably damaging 1.00
IGL02949:Lct APN 1 128,240,869 (GRCm39) missense probably benign 0.26
IGL02951:Lct APN 1 128,227,948 (GRCm39) missense probably damaging 1.00
IGL03087:Lct APN 1 128,228,112 (GRCm39) missense possibly damaging 0.81
IGL03227:Lct APN 1 128,255,426 (GRCm39) missense probably benign 0.09
ANU18:Lct UTSW 1 128,235,784 (GRCm39) nonsense probably null
R0071:Lct UTSW 1 128,219,755 (GRCm39) nonsense probably null
R0071:Lct UTSW 1 128,219,755 (GRCm39) nonsense probably null
R0135:Lct UTSW 1 128,212,860 (GRCm39) missense probably damaging 0.98
R0145:Lct UTSW 1 128,255,632 (GRCm39) missense probably benign 0.00
R0179:Lct UTSW 1 128,255,422 (GRCm39) missense probably benign
R0331:Lct UTSW 1 128,226,479 (GRCm39) splice site probably benign
R0366:Lct UTSW 1 128,214,199 (GRCm39) missense probably benign 0.03
R0399:Lct UTSW 1 128,228,262 (GRCm39) missense probably damaging 1.00
R0492:Lct UTSW 1 128,228,319 (GRCm39) missense probably damaging 1.00
R0548:Lct UTSW 1 128,212,932 (GRCm39) missense probably damaging 1.00
R0691:Lct UTSW 1 128,235,971 (GRCm39) missense probably benign 0.00
R0755:Lct UTSW 1 128,221,872 (GRCm39) missense possibly damaging 0.46
R0839:Lct UTSW 1 128,214,346 (GRCm39) missense probably benign 0.00
R1128:Lct UTSW 1 128,229,046 (GRCm39) missense probably damaging 0.99
R1135:Lct UTSW 1 128,221,861 (GRCm39) critical splice donor site probably null
R1321:Lct UTSW 1 128,227,759 (GRCm39) missense probably benign
R1448:Lct UTSW 1 128,235,559 (GRCm39) missense probably damaging 0.99
R1450:Lct UTSW 1 128,235,640 (GRCm39) missense probably damaging 1.00
R1572:Lct UTSW 1 128,221,932 (GRCm39) missense probably benign 0.25
R1582:Lct UTSW 1 128,228,299 (GRCm39) missense probably damaging 1.00
R1668:Lct UTSW 1 128,215,459 (GRCm39) splice site probably null
R1757:Lct UTSW 1 128,228,994 (GRCm39) missense probably damaging 1.00
R1775:Lct UTSW 1 128,228,038 (GRCm39) missense probably damaging 1.00
R1792:Lct UTSW 1 128,255,679 (GRCm39) missense possibly damaging 0.54
R1815:Lct UTSW 1 128,227,896 (GRCm39) missense probably damaging 1.00
R1932:Lct UTSW 1 128,221,898 (GRCm39) missense probably damaging 1.00
R2325:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R2381:Lct UTSW 1 128,231,858 (GRCm39) nonsense probably null
R3001:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3002:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3011:Lct UTSW 1 128,229,109 (GRCm39) missense possibly damaging 0.74
R3082:Lct UTSW 1 128,215,345 (GRCm39) missense probably damaging 1.00
R3683:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3684:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3726:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3886:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3887:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3888:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4019:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4027:Lct UTSW 1 128,212,918 (GRCm39) missense probably benign 0.00
R4226:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4409:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4514:Lct UTSW 1 128,228,251 (GRCm39) missense probably benign
R4570:Lct UTSW 1 128,227,641 (GRCm39) missense probably benign 0.01
R4776:Lct UTSW 1 128,228,124 (GRCm39) missense probably damaging 0.99
R5001:Lct UTSW 1 128,235,978 (GRCm39) missense probably damaging 0.96
R5021:Lct UTSW 1 128,228,302 (GRCm39) missense probably benign 0.38
R5318:Lct UTSW 1 128,232,109 (GRCm39) missense probably damaging 1.00
R5330:Lct UTSW 1 128,226,266 (GRCm39) missense probably benign 0.06
R5385:Lct UTSW 1 128,239,354 (GRCm39) missense possibly damaging 0.63
R5499:Lct UTSW 1 128,214,414 (GRCm39) missense probably damaging 1.00
R5508:Lct UTSW 1 128,221,868 (GRCm39) missense probably damaging 1.00
R5642:Lct UTSW 1 128,222,969 (GRCm39) missense probably damaging 1.00
R5724:Lct UTSW 1 128,228,073 (GRCm39) missense probably benign
R6026:Lct UTSW 1 128,227,755 (GRCm39) missense probably benign
R6044:Lct UTSW 1 128,235,717 (GRCm39) missense possibly damaging 0.95
R6175:Lct UTSW 1 128,255,451 (GRCm39) missense probably damaging 1.00
R6277:Lct UTSW 1 128,231,974 (GRCm39) missense probably benign 0.01
R6412:Lct UTSW 1 128,255,455 (GRCm39) missense probably benign 0.00
R6480:Lct UTSW 1 128,222,057 (GRCm39) missense probably damaging 1.00
R6526:Lct UTSW 1 128,228,215 (GRCm39) missense probably benign 0.05
R6620:Lct UTSW 1 128,222,809 (GRCm39) critical splice donor site probably null
R7214:Lct UTSW 1 128,228,197 (GRCm39) missense probably benign 0.00
R7308:Lct UTSW 1 128,246,824 (GRCm39) missense probably benign 0.00
R7577:Lct UTSW 1 128,228,469 (GRCm39) missense probably damaging 0.99
R7626:Lct UTSW 1 128,212,932 (GRCm39) missense probably damaging 1.00
R7737:Lct UTSW 1 128,226,430 (GRCm39) missense probably benign 0.12
R7901:Lct UTSW 1 128,216,722 (GRCm39) missense probably benign 0.44
R8033:Lct UTSW 1 128,212,996 (GRCm39) missense probably benign 0.03
R8373:Lct UTSW 1 128,231,577 (GRCm39) missense probably damaging 1.00
R8504:Lct UTSW 1 128,215,306 (GRCm39) missense probably damaging 1.00
R8751:Lct UTSW 1 128,221,534 (GRCm39) missense probably benign 0.18
R8781:Lct UTSW 1 128,215,261 (GRCm39) missense probably damaging 1.00
R8797:Lct UTSW 1 128,231,684 (GRCm39) missense possibly damaging 0.77
R8926:Lct UTSW 1 128,228,148 (GRCm39) missense probably damaging 1.00
R8949:Lct UTSW 1 128,221,929 (GRCm39) missense probably damaging 1.00
R8992:Lct UTSW 1 128,228,299 (GRCm39) missense probably damaging 1.00
R9138:Lct UTSW 1 128,227,894 (GRCm39) missense probably benign 0.03
R9260:Lct UTSW 1 128,227,704 (GRCm39) nonsense probably null
R9416:Lct UTSW 1 128,228,329 (GRCm39) missense possibly damaging 0.74
R9531:Lct UTSW 1 128,235,598 (GRCm39) missense probably benign 0.00
X0052:Lct UTSW 1 128,235,367 (GRCm39) missense probably damaging 1.00
YA93:Lct UTSW 1 128,229,057 (GRCm39) missense probably damaging 1.00
Z1176:Lct UTSW 1 128,215,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGACCTAGGAAATCCGCAGAG -3'
(R):5'- GGAACTTGGGAACAGTGACTTG -3'

Sequencing Primer
(F):5'- TAGGAAATCCGCAGAGCCTTTCAG -3'
(R):5'- GAACAGTGACTTGATAGTGTCTCTC -3'
Posted On 2015-01-11